Transcript asmbl_13703

Sequence
Transcript Sequence for observation asmbl_13703 of TGE0003691:
AATACATGATATGCCGTTTAAATGTGTGGCCACGGTGTGAGCTAACACTGGCTGCCTGTCTCCATAGGTCGTGTGATAGCCACTTTCGCTTGTTCTGGAGAAAAGGAGGTAAATTTGGCTGTGCAGAATGCCAAGGCTGCCTTTGAAGTATGGAGTAAAAAATCTGGCATGGAGCGTGGTCGAATCCTTTTGGAGGCTGCCAGGATCATTAGGGAACGGAGGGATGAAATTGCCACCGTGGAGACCATCAACAATGGCAAATCCATCTTTGAGGCCCGCTTGGATGTTGACAGTTCCTGGCAGTGCCTGGAGTATTACGCAGGCTTGGCCGCGTCCCTGGCCGGTGAACACATCCAGCTCCCAGGCGGGTCCTTCGGCTACACCAGGAGGGAGCCGCTCGGCGTGTGTGTGGGGATAGGCGCCTGGAACTACCCCTTCCAGATCGCCTGCTGGAAGTCGGCGCCAGCTCTGGCCTGCGGTAACGCCATGGTCTTTAAGCCGTCTCCCTTCACGCCTGCATCCGTGCTGCTGCTGGCCGAGGTCTACGCCCAGGCCGGGGTGCCTCCCGGCCTCTTCAACGTGGTGCAGGGGGGCGCCGCCACGGGCCAGCTCCTATGCCAGCACCGCGACGTGGCCAAGGTCTCCTTCACCGGCAGCGTGCCCACGGGCACGAAGATCATGGAGATGTCGGCGAAGGGGATCAAACCCGTCACCTTGGAGCTGGGCGGCAAGTCCCCGCTGATCATCTTCTCAGACTGCGACCTGGACAGCGCCGCCAAGGGGGCGCTGATGGCCAACTTCTTGACACAGGGAGAGGTTTGCTGCAACGGCACGAGGGTATTCGTGCAGAAGGAAATTCTCGACAGATTTACCGCAGAAGTGGTGAAACAGACCAAAAGGATAAAACTCGGGGACCCCCTTCTAGAGGACACCAGGATGGGCCCCCTCATCAACCGGCCACACCTGGAGCGTGTCCTTGGGTTCGTCAAACTGGCAAAGGAGCAGGGCGCTACAGTGTTATGTGGTGGAGAGCCCTACGTGCCCGAGGACCCCAAGTTAAAGGACGGGTTCTACATGACGCCTTGCGTGTTAACTCATTGCAGGGACGACATGACCTGTGTGAAAGAAGAGATCTTTGGACCAGTTATGTCCATTTTATCATTCGACACCGAGGCTGAGGTTCTGGAAAGAGCCAACGATACCACGTTTGGACTGGCCGCTGGCGTCTTCACCAGGGACATCCAGCGTGCTCACAGAGTGGTCGCCGAGCTCCAGGCCGGAATGTGCTTCATCAACAACTACAGCACCTCCCCCGTGGAGCTGCCCTTTGGAGGGTATAAGAAGTCAGGGTTTGGCAGAGAGAACGGCCGTGTGACCATCGAGTATTACTCACAGCTAAAGACTGTGTACGTGGAGATGGGCGATGTGGAGTCTGTGTTTTGAAATCGCGCCGTGAAACCCGTCGACGTGGCCAGGCCGAGGAACAGAGAGGACCGGCCCTCTCGGCGGGCCCGGCCTTCCCCATCCCCCACCCCCCTGCACCCCGCTTCCGTCACTGGGGACAGGATTCGTCACCCAGACATCTTCCTAACTGAAACTGTAGAAGTGCCTTCTCCT