Transcript asmbl_13643

Sequence
Transcript Sequence for observation asmbl_13643 of TGE0003685:
CTGGAGCCGAGTGTGAACCTGAGGAAGGAGCGGGGCCAGCGCGCAGGCCCGGAACCGCCGGAGCCGGGGCTGCCGGCGACGCCCCAGAGCGGAAGAGGGAAGTGAAGGCACCAGGCTGCGGGTTCCTGTCTGACTGGGCTTGCTAAGGTAGAGGCAGCACGGAGAAGAGGCCTTTGCCACCGCTCCGGATCGGAGATGTCGAAGAACACGGTGTCGTCGGCCCGGTTCCGGAAGGTGGACGTAGATGAGTACGACGAGAACAAGTTCGTGGACGAAGAAGACGGGGGCGACGGACAGGCGGGGCCCGACGAGGGCGAGGTGGACTCCTGCCTGCGGCAAGGAAACATGACAGCTGCCCTGCAGGCAGCTCTGAAAAACCCCCCTATCAACACCAAGAGTCAGGCTGTGAAGGACCGGGCAGGCAGCATTGTCCTGAAAGTGCTCATCTCTTTTAAAGCTAATGATATTGAAAAGGCAGTTCAATCCCTGGACAAGAATGGTGTGGATCTCCTAATGAAGTATATTTACAAAGGCTTTGAGAGCCCCTCTGACAATAGCAGTGCTGTGTTATTGCAATGGCATGAAAAGGCACTTGCTGCTGGAGGAGTGGGGTCCATCGTTCGAGTGTTGACTGCCAGAAAAACCGTGTAATCCAGCAGGAGCTGGATGTCTCCTGTGGGTGTGGGAATTGCTGGTACAAAGACCAAAACAACCAAATGCCACAGCTGCCCTTTGGGTAGCATCTATTTCTCTCAGCTTTGCCTTCTTGCTTCCTCTTTCATATCTATAAAGAAGAAAATTACATATCAGTTTTCCTTTAATGAAAATTGGGATGACATAGAGGGAATGTTTCAACAGAAGTGTTTCATGCTCTCAAAACTATTTCAGTGATGTGTATACCAATCTGTATATAGTATAATTTACATTCACGTTTAATTGTGTAATTTCTAACCCCTTAATTGGCTGGCATTTTTTGTTTTTCTGTTTTTTGTTTTTGGTTTTTTAGTTTTGTTTTTAACTAATAGTGATCTAAATTGGATGCTGGTTTCCTAACTCGTTGCTAGCCAGGAAATGACTCTTATAAAAAATATTTTTCAGAGACTGGCAGCTATTAACATTGCAAAACTGGACCATACTTCCTTTATTTAAGCAAAATGTGTTTCTGGGACAAGTGGTGGGTGAGCACCACTACCGCGTTCCAGTTTTGTTTCTGCTTGCCTCCAGATCATGTGAGTTTAAGTATGCTTCTTCCTCTCAGCATCCAATAATCATGGCCTCTCGATTTCTTTGGTCACCAGGGTCCAGAGCAAGGAGTCTTGCTCTATGCAGATGTATCTATAAAATACCAGAGCCTTTTTGGCATGAGCATAAAACTTTGTTTCAATTATGTGGCCCTATTTGGAGAAACTACTCCAAATCAGAAAGGACATGGAAACTATGATGTAGTTCAAACTCTGGGCGGCCTCCGAATGAAATGATACTTCCCATAGAGCTATAGTAGCTGCCTTAGACATTATGAGGTATATAACCAGTATTTAATATGCCCTATAAATGTCTTCAGTGTTCTTCAGGGTAATTGGGATCTCAAAAGATTTGGTTCAGATCCAAACACGCACACATTCTGTATTTTAGCTCAGTGGTTT