Transcript asmbl_39315

Sequence
Transcript Sequence for observation asmbl_39315 of TGE0054885:
GCCAGGGCCGGGAGTCTTAGAACCGAGGGCCCGCAGGGGTCCCCGCGGCCGCTGCAATGCAGAAATACGAGAAACTGGAGAAGATTGGGGAAGGCACCTATGGAACTGTGTTCAAGGCTAAAAACCGGGAAACTCATGAGATTGTGGCTCTGAAGCGTGTCAGGCTGGATGATGACGATGAGGGTGTGCCAAGTTCAGCCCTCCGGGAGATCTGTCTACTCAAAGAACTGAAGCACAAAAACATTGTCAGGCTTCATGATGTCCTGCATAGTGACAAGAAGCTGACACTGGTTTTTGAGTTCTGTGATCAGGACCTGAAGAAATATTTCGACAGCTGCAATGGTGACCTGGACCCTGAGATTGTGAAGTCATTCCTCTTCCAGCTGCTGAAAGGCCTGGGATTCTGTCACAGCCGCAACGTGCTACATAGGGACCTGAAGCCCCAGAACCTGCTCATAAACAGGAATGGGGAGTTGAAATTGGCTGATTTTGGCCTGGCCCGAGCCTTTGGTATCCCCGTCCGCTGCTACTCTGCTGAGGTGGTCACGCTGTGGTACCGCCCACCGGATGTCCTCTTTGGGGCCAAGCTGTACTCCACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCAGAGCTGGCTAATGCAGGACGACCTCTCTTCCCTGGCAATGATGTGGATGACCAGCTGAAGAGGATCTTCCGA