Transcript asmbl_12956

Sequence
Transcript Sequence for observation asmbl_12956 of TGE0003671:
CCGGACCGTGGTCGTGCTGGGCGGAGGCATCAGCGGCTTGGCCGCCAGTTACTACCTGAGCCGGGCCCCCTGTCCCCCCAAGGTGAGTGGCAGCAGGAGCTTCCTCTACAGCCTCCTCCGGTTCCAGCAGAAGGCCGCCCCAGACCCTTCCCCCGGGCTGAGGCCGCGCCGCCGCGTGTACCCCTGGCCCGCAGGTGGTCCTGGTGGAGGGCAGCGAGCATCTGGGAGGCTGGATCCGCTCCTTGCGCGGCCCAGACGGCGCTGTCTTTGAACTTGGACCTCGAGGAATTCGGCCAGCAGGAGCGCTGGGCGCTCGGACCCTGCTCCTGGTGTCTGAGCTCGGCCTGGACTCCGAAGTGCTGCCCGTCCGGGGGGACCACCCTGCGGCCCGGAACCGGTTCCTGTACGTGGGCGGCGCCCTGCACGCGCTGCCCTCCGGCTTCAGGGGGCTACTCCGCCCTGTGCCTCCCTTCTCCAAACCTCTGTTTTGGGCTGGGCTGAAGGAGCTGACTGCACCCCGGGGCAAAGACCCTGACGAGACTGTGCACAGTTTTGCTGAGCGCCGCCTTGGACCTGAGGTGGCGTCTCTCGCCATGGACAGCCTCTGCCGTGGAGTATTTGCAGGCGACAGCCGGGAGCTCAGCATCCGCTCTTGCTTTCCCAGTCTCTTCCAGGCGGAGCAAAGCCATGGCTCCGTGTTACTGGGGCTGCTGCTGGGGGCAGGGCGGAGCCCACAGCCCGACTCAGCCATCATTCGCCAGGCCAGAGCTGAGCGCTGGAGCCAGTGGTCACTCCGTGGAGGACTGGAGAGGTTGCCTCAGGCACTTCACAGCCACCTGACTCGTAGGGGGATCAGTGTTCTCAGAGGCCAGCCAGTCTGTGGGCTCAGCCTCCAGGCAGGAGGGCACTGGAAGGTGTCTCTAGCGGACTGCAGCCTGGAGGCTGACCATGTCGTCAGTGCTATTCCAGCTTCAGCGCTCGGCGCGCTGCTGCCTGCCGAGGCCTCACCACTGGCCGAAGTCCTGAGAACCATCCGAGCGGTGTCTGTGGCTGTGGTGAATCTGCAGTACCGCGGAGCTCGTCTGCCTGTCCAGGTGACACCGCGGAAGGGGAGACGCGGGCTCAAGTTCACGCCTCCCGGCTGAACCCATCCCTTCCTTTTGTCCAGGGGTTTGGACACTTGGTGCCGTCCTCGGAAGACCCAGGCGTCCTGGGGATCGTCTACGACTCAGTTGCTTTCCCTGAGCAGGATGGCAGCGCCCCCAGCCTCAGAGTGACTGTGATGCTGGGAGGTTCCTGGTTACAGACGCTCGAACCCGGAGGCTCCGGCCTATCCCGGGACCTGCTCCAACGCCAGGCACAGGAAGCAGCTGCCACACAATTAGGACTGAAGGGGCCACCAAGTCATTGCTTGGTTCATCTACACAGGAACTGCATCCCCCAGTATACACTAGGCCACTGGAAAAAACTGGAGTCAGCCACCCAGTTCCTGGCTGCTCACAGACTGCCCCTGACTCTGGCCGGAGCTTCCTATTGGGGGGTCGCTGTCAATGACTGTATAGAGAGTGGACGCCAGGCAGCAGCCCAGGTCCTGGGCTCAGCACCCCATAGCTGATCCCCACTCCCAGCACCTGCCTGCTGGCGGGGAGTCTCTCACCCATGACAATAAAAGTTGCTGGAGGTTG