Transcript asmbl_38948

Sequence
Transcript Sequence for observation asmbl_38948 of TGE0040697:
CTGGAGGACAGCGGTGTCGCGAGTCGGCGATCGGTGGTCCGCGGCAACGCCGAGAGGCCGTACGGGAACGCGGGCGCCGGAGCTCAGAGGTTGACTCTTCACCACACTGAAGCCGTTAGGAAAACAAACCTTGTGGTTATCAGCAGAGCCTTCAGAGTTTCACCATAACTCAGGCCTAGACATTATTCTAAATGGCAACTGATATGTCTCAAGGTGAACTCATCCATCCTAAGGCACTCCCACTTATAGTAGGAGCGCAGCTGATCCACGCGGACAAGTTAGGTGAGAAAGCAGAAGATACCACCATGCCTATACGTCGAGCCGTGAATTCTACCCGGGAAACTCCACCCAAAAGCAAACTTGCTGAAGGGGAGGAAGAAAAACCAGAAGAACAGGAGAATGAGACTCCACCTGCTACATCCAGTGAGGCAGAGCAGCCCAAGGGGGAGCCTGAGAGTGGAGAGAAGGAAGAGAACAACAACAAGTCTGCTGAGGAACCCAAAAAGGATGAGAAGGATCAGTCTAAAGAAAAGGAGAAGAAAGTGAAAAAGACGATTCCTGCCTGGGCGACTCTCTCTGCCAGCCAGCTAGCCAGGGCCCAGAGACAAACCCCCATGGCTTCCTCCCCACGGCCCAAGATGGACGCAATCTTAACTGAGGCCATTAAGGCATGCTTCCAGAAGACTGGCGCCTCGGTGGTTGCGATTCGAAAGTACATCATTCATAAGTACCCGTCTCTGGGTCTGGAGAGAAGGGGCTATCTGCTCAAGCAAGCGCTGAAGAGAGAGTTAAACAGAGGAGTCATCAGACAGGTAAAAGGAAAAGGTGCATCTGGCAGTTTTGTTGTGGTCCAGAAATCAAAACCACCTCAGAAATCCAAAAACAGAAAGAAGGGCTCGGCTCTGGATCCAGAACCACAAGTAAAACTGGAAGATGTTCTCCCGTTGGCTTTTACTCGGCTCTGTGAACCTAAAGAAGCTTCCTACAGTCTCATCAGGAAATACGTGTCTCAGTATTACCCTAAGCTCAGAGTGGACATCAGGCCCCAGTTGTTGAAGAATGCTCTGCAGCGAGCAGTAGAGAGAGGCCAGCTCGAGCAGATAACTGGCAAGGGTGCTTCGGGGACATTTCAGCTGAAGAAATCAGGGGAGAAGCCCCTGCTGGGTGGAAGCCTGATGGAATATGCAATCTTGTCTGCCATTGCTGCCATGAACGAGCCTAAGACCTGCTCCACCACTGCTCTGAAGAAGTATGTCCTGGAGAACCACCCAGGGGCCAACTCTAACTATCAGATGCATTTGCTGAAAAAAACCCTGCAGAAATGTGAGAAGAACGGGTGGCTGGAGCAGATCTCTGGGAAGGGGTTCAGCGGCACCTTCCAGCTGTCCTTCCCCTACTACCCTAGCCCAGGAGTTCTATTTCCGAAGAAAGAATCCGGTGGCTCTGACGATGAAGATGAAGATGACGATGACGATGAATCATCAGAAGACTCTGAGGATGAGGAACCACCACCCAAGAGGAGCTTACAGAAGAAAACACCAGCCAAGTCCCAAGGGAAGACAGCCTCCATGAAGCAGAGAGGGTCGAAGCCTGCGCGGAAAGTCCCGGCTGCCCAGAGAGGGAAAGTGAGGCCGCTGCCTAAGAAAGCTCCACCCAAGGCCAAGACCCCTGCCAGGAAAGCCAGACCCTCTCCCTCAGTCATCAAGAAGCCTAGTGGGAGCTCCTCCAGAAAGCCCATAGCCAGTGCACGAAAGGAAGCGAAACTGCCCGGGAAGGGCAAATCTGCCATGAAGAAGTCTTTCAAGACAAAAAAGTAAATTTTATAGGGAAAAGGGTATCATGATTGAATTCAGAATCTTACTTTATAAGGTCAGTGTGCATTTGTTCTAGTTATAATGCTTTTAAATTGTACTTTTTCTTCCCATGTGAGCATTGTGGGAAGGAATGGACACAGAGCAGCGTAGACATTTGTGAGCTTCGGTGCTGTTCAGTGCCTGCTTCTTCATCACCTTAATTTCTGCCATAACCTGGACTTCGCTGACTGTGTGACTGCCCTGCTCCCTCTGTTCATCTTAGCCCCAGCCCTCGTCCTCTTTCTGTGATCCGATTGAGGATTTTTTCCTCCTTCAAGTTAATTTAAACAACTGCAGAGATGTGTTTGTAGAGCACTTAGAGGTCTGGGGCTGGAAGTCCAGACGGCGCAGGAGCAGTGTTGGGAAGGCTTTGCGTCCTGCCTGCAGACTTGCTAGAGCTGTGGTGATTAACCCTGGCTGTTGAATCACTCCACTGACCAGTCTCCAGCTTGAGTCGGGGACATGTTAACTTCGGAAAGAAGCCCCCGTCCCTGCCATCCCATAGATTCTGAAGGGCTCCTCTCCTCCGGTCACGCTGACCAACTGCCAAGCTCGCTTTGCTGCCCAGAGCACTGTCCCCTCACAGCAAGCACAAGTTGTCTGCACCACTTGGTTTCTGACTGAAGGGGAAGTACAGGACTACATGGAATCTGATTTCTGGTGTTGCTTATTACCAAAAATGACAGAATATTCTTGATCAAATGTCTAGATATATTTTTAATATTTGGGGCATGAGTTGTCCCTGTTTGAGAGTTCCCATTACTAATGTAGAAATGTTAAATGGTAAAACATAATTTGCTAAAATGACCAGTTTTCAGATTCACCTGTGCGTGTGCCCCCCACTCCCATCCCACCCTGTTCTTTCCATAGAACTTTTGATATCAGGCAAACGGTTTCCTTTTTGAGATATTTTAACAGAGAAGGGGTGGGGGAGAAGCAGATGAAGCTGTACTACCCAGCCCTCTTCTTGTTTGTATTTGTTTAGGGTTGTGAGGTTGTGTAAAATAGTACTAGCTTCTTACTTGAGAACTACAGTTTCTGCTTATCATTTATTCTTCCTTGTGGCACTTAATATTTTAATTGTCTTAAGCTTTTTGATGTATATATCCTCTGGCCCCTTACATGCTGCCAGAGGAGAAGGTGTTTGTTTGAGATTCATTCCACTTGAAGTGTCTCCTGGGATCCCCACAGCTGCGTATGGCTGGGAAATGGACTTAAGGCTTGGGCTTGAATTGGTGGCTCCTACCTGTGAGGTCCCATCGTGAGTCACTGGGATTTGTGTTGCATGGAAGGCAGTCTTTCCTGTTGTAAATCTTCCTTTTTTATGTACAAATATTTTGAAAAATATGAATAAACATGAACTTTTAAAA