Transcript asmbl_12935

Sequence
Transcript Sequence for observation asmbl_12935 of TGE0003665:
GTTTTTTAATGCGCTTATTTTTAGCAGGAAAAAACCCATTGGGTTTTGAGGCTGAACTTTGACCTGCTATCGATCCCTTTTCTCTTGTCGGTTTGCAGCTGCAGAAACGGCGCGGCTGTTCCCACAAAGCGTGGCTAGCGGAGCGCCATGAGCAGAGCACCCAGCGATCTCAAGCTCAGGCTGGCCCGGGCTGGGCAGGAGCACCTGCTGCGGTTCTGGGATGAGCTGGAAGAGGCCCAGCGGGCGGAGCTCTGTGCGGAGCTCCAGGCCATGGACTTCGAGGAGCTGAGCATCTTTTTCCAGAAGGCCACCGAAGGAGTCCACCAGTTCTCTCAGCTGGAGAAGGTGGATGCGCGGATGGAGCCTATCCCTCGGGAAGTGCTGGGCAGCGCTACGCGGGATCAAGATCAGCTCCAGGCCTGGGAAAGTGAAGGACTTTTCCAGATTTCTCAGAACAAAGTGGCTGTTCTTCTTCTAGCTGGCGGACAAGGGACAAGACTTGGTGTCTCGTATCCCAAGGGGATGTACGATGTTGGGTTGCCATCTCATAAGACACTTTTTCAGATTCAAGCAGAGCGGATCCTGAAGCTTCAGCAGTTAGCTGAAAAATACCATGGCAACAAGTGCACCATCCCGTGGTATATAATGACGAGCGGCAGAACAGTGGAGTCCACAGAGGAATCCTTCACCAGACACAAGTACTTCGGTTTGAAAAAGGAGAATGTGATCTTTTTTCAGCAGGGAATGCTACCAGCCATGAGTTTTGATGGGAAAATTATTTTGGAAGAGAAGAATAAGGTTTCTATGGCTCCAGATGGAAACGGTGGTCTTTACCGGGCTCTTGCGGCCCAGAACCTCGTGGAGGATATGGAGCAGAGAGGCGTCGAGAGTGTTCACGTGTACTGCGTCGACAACATTCTGGTCAGAGTGGCGGACCCCCGGTTCATCGGATTCTGCATTCACAAGGGAGCAGACTGTGGGGCGAAGGTGGTGGAGAAGACGAACCCCACGGAGCCGGTGGGCGTGGTGTGCCGGGTGGACGGCGTGTACCGCGTGGTGGAGTACAGCGAGATCTCCCTGGCCACCGCGCAGCGGCGGGGCCCCGACGGGCGGCTGCTGTTCAGCGCGGGCAACATCGCCAACCACTTCTTCACCGTGCGGTTCCTGAGAGACGTGGTCAGTGTTTATGAACCTCAGTTGCAGCACCATGTGGCTCAAAAGAAGATTCCATTTGTGGATCCCCAGGGGCAGTTAATTAAGCCAGACAAACCAAATGGAATAAAGATGGAAAAGTTCGTCTTCGACATCTTCCAGTTTGCAAAGAAGTTCGTGGTGTATGAGGTGTTACGGGAAGACGAGTTCTCCCCACTCAAGAACGCGGACAGTCACAGTGGCAAGGACAACCCCACCACGGCCAGGCACGCTCTGCTGTCCCTTCACCACCGCTGGGTGCTCAACGCGGGGGGCCACTTCGTAGACGGAAATGGCTCCCGCCTGCCCGCGATTCCCTGCTTGAAGGATGCCCACGACGTCCCTATCCAGTGCGAGATCTCCCCTCTCGTCTCCTACGCCGGAGAGGGACTAGAAAGTTACGTGGCCGGCAAAGAATTCCACGCGCCTTTAATCATTGGCGAGAATGGCGTCTGTGAGCTGGTGAAGGACGGCGTATGAGCCAGGTGCCAAGTTCCCCGCAGCGAGAGCAGCGCTTACGTGTGACAGACCAACTGTGAGCCTCCAGGCCCCTCCTGAGGCTACTCAAGTTCGAATGTCCACGAGTCTCCTTCTGCCTGTCGAACTCTCCTAACTACTACGTAGCCCCTGAGAAGCAGCGGCCTGAACTGCAGAGAGCACCGTTAAGGTTCTCAACTCACTGACGGTCTTATTTATAGTTTTCAGTTGTATAAAATTTTCCCCAGGCCAAGGACAGCAGTGCCACCCACGCAGTTCCCTGCAGCGTGAGGGTGGCCAGGCGTGCGCCCGCCCTTCGCCTGGGGCTAGAAGCTTGTCTTCAGAGTTCTTCGGGGTGACAGTACGCCCTTGTACATGTCAGAAGGTTTCTGCGATACTACAAGTTTGTTTTATTTTATCAAAAGTAAGCTTTTTCAAGAAAATAATTGGACAGTAAAATAAACTTTTCTTTTTGTCTCTGGAGTGTCATTTGTACCTTGAGGAATTTATTCCATTCAGAAAATATGAAACTTGGGAGAAACTGA