Transcript asmbl_12924

Sequence
Transcript Sequence for observation asmbl_12924 of TGE0003662:
GCAGGGCAGCGGGCAGTGCAGGGCCTGCGGCGACACCGCTTTGAAAGCGGCCTGGGGCGCTGCGCGCGCTGCGGATGTGGAAGTGTCGCTAGGGCCCCTCCGAGGGCCCCTGGGGAATTGTGTTTGTTTTCCTCCTGCCTCATAGAAACGTTTGCCAGTTCGTAGTGGAACCTTTAAGTGGGTCGTTTCCTACCTCTGCCTTGGAGCTGGAGACCCCGCAGGGAGCGAGGCGGACTCTTCATTCACGGTCCTGCCTTGAGGTTCTGAGAACTTCCCCCTCTATCTGGTGTCGCTGCCCGGAGCCCGCGGGCCACAGCGAAGGGGCGGCTGCAGGGTGTGGAAGGGACCGGAAGCTCGTTGAGCCAACATGGCCGTCCTCTCCAAGGAGTATGGCTTCGTGGTGCTGACGGGGGCCGCCAGCTTCATCATGGTCGGCCATCTGGCCTTCAATGTGTCCAAGGCCCGCAAGAAGTACAAGGTGGAGTACCCCACCATGTACAGCGCAGACCCCGAGAACGGACACCTGTTCAACTGCATTCAGCGAGCCCACCAGAACACGTTGGAAGCGTATCCGGCCTTCTTGTTTTTTCTAGCTGTTGGGGGTGTTTACCACCCGCGAGTAGCTTCCGGTTTGGGCCTGGCCTGGATTGTCGGACGGGTTCTCTACGCCTACGGCTATTACACAGGAGACCCTAGCAAGCGGAGCCGGGGGGCGCTGGGCTCCGTCGCCCTTCTCGGCTTACTGGGCACCACCGTGGTCTCGGCCTTCCAGCACCTCGGCTGGCTTAGACCTGGCTTGGGCAGTGAGTGCAAATCCTGCCATTAAAGAATGATAGGGTGTCTGAAAACTCTGATTTCGTCCCGAGTGACTTTTATTTCCAGTTACAGTTTTTCTAAATATAATAAAAATTTATCTGGCATCAGCCTCATACGTAA