Transcript asmbl_3834

Sequence
Transcript Sequence for observation asmbl_3834 of TGE0005318:
GAACAACAAAGCGAGAAACCGAGCTCGAGCCTTGGGGGGCTCCTAGCAACGGGCCTGGGCGGGAGTTCCATGGAGACTGGGGAGCGGACCCGTTTTATCTTCATCCTTGTCCTCCAGCTTCTTCTCCGCGTCCGACGCAACCAGCAGCAGCGCTGCCGCCGTGTCCTTTACGACCGCCCCGTCTTCCCACGGATGTGATCTTCGTGGTGGGAACCAAGTTTCTAAACTACCCCAATGGATGCAGACAGTGATGTTGCATTGGACATTTTAATTACAAATGTAGTCTGTGTTTTTAGAACAAGATGCCATTTGAACTTAAGGAAGATTGCTTTGGAGGGAGCAAATGTAATTTATAAGCGTGATGTTGGGAAAGTATTAATGAAGCTTAGAAAACCTAGAATTACAGCTACAATTTGGTCCTCAGGAAAAATTATTTGCACTGGAGCAACAAGTGAAGAAGAAGCTAAATTTGGTGCCAGACGTTTAGCCCGTAGTCTGCAGAAACTAGGTTTTCAGGTCATCTTCACAGATTTTAAGGTGGTGAATGTTTTGGCAGTGTGTAACATGCCCTTTGAGATCCGTTTGCCAGAATTTACAAAGAACAATAGACCTCATGCCAGCTATGAACCTGAACTTCATCCTGCCGTGTGCTATCGGATAAAGTCTCTAAGAGCTACATTACAGATATTTTCAACAGGAAGCATCACAGTGACAGGGCCCAATGTAAAGGCTGTGGCGACTGCCGTGGAACAGATCTACCCGTTCGTGTTTGAAAGCAGGAAGGAGATTTTATAACTCAAACTTGGTTGGTTAGTCTCCACCTGAGCACCGTTTGAGACCTGCTGCACATTGGACTCAAAACACAAGGAAAACTGGACCAACAGTGACCGAGGACAGACTCGGACTCACAGCTGCAGTGTAAGCTCCAGTCCCTTTGGATTTTACTTCAAAGTTTGCTGTAATATAAAAAGGAAGTTTACAAGACATGACATTGCTGCTTTTACAAAAGGACGTTCTATTTATTTTCGCAGTAATCTCCATGTCCCACAGGCAGAGCTGTCGCAGTGTGCACTTCCCGACAGTTGTTTTATTGATGTCATTATTTTTCCAGTTGGAGCTAATGTGTTTGATTTGTGAATAGTCTTTTACATTTTTGTATGCTGAATATGGGCACCAAAGAACCTGTAAACGTTATCTTTTTAAATTGAATGTGCACAAATAAAAGTTTGGAAAAGATCTCTCTTCATATCCATTCTGTAACTTTTATTCACCATTTTTTTCTTTTAAACAACTGTATTCATAATTTTTTTTAAATCTATGCAGGCTTAGACTTTGGCTAAAGTGTGTGGGCTTCTTTTTGAAGTGAGTTTGTATATATTTGTGTGTATGCTACATGTATATAGTATCTTTTCATGCTCTGTTACCAAATATCAATTAGAATGTTCTCCTCGCAGATTGGAAGTAAAAACCATGTATATAAGCTCTAGGTAACTAGGGTAGAACTCCACAGGTAAATGATAATGTTTGTGTTACTAATTTAATATGATAGAAAATGTTAAATGCGTTTGAAAAGCTAAGAGGTTGTAGTTTTGAAGAGAGGCCTTTTCCTGTCTAGGTGGATCTGCAGTAGCCCCGTAACCCTTGTTATTCTGGAAAGCTGGCTGTAGATGAACGAGCCAGCAGAGGTTCTTAACTACCCTTAGGTCGGTGCTCAAGGCTATGCTGGTCTTGTCAGAAATTGACTGACATTGTGTTTTAACAAGAAGTGGCTCGACTTGACCCAAAGCCTCTGGCAAGCTGGTCTCTGTCCTCGCCGTGTCTGAGTAGTGCATGTGAAGGGTGACTGGAGGATTAAGAGAGGCCACTCTTAAACTTCAGTTCCATGAGACAGGGCCTCAGCCGTGCATGGGCTCTGGGTGGAAAGGCATGGTCGGACAGGTGCTTAGTGTAGCCAGGAGTGGCTTTACCTACCAATAAACTAGGTGGAGTCAAAACTTAGATTCTCTGTACAGACGAAACTATTTCCCACCAAGCTCTGACTTACTGTTGTATTTTTGAAATGTTTGCAAAGGCTTGTGACATGTGCACCATATTACAGACCTTCCAAGGCTAACTTAAGCACTGGCTGGGCAGTGCATAGGAGTCTGTGTTCAGTTCTGTTTTCTTAAAGCCTCCTCATCCCCTGCCCCTCAGCTCCTTCAGAACGTGGGAGCAAAGGTGAGCTTTGCACTTGCTTTTCCCATAATTCATTGTGACTTTTTAAAGCCTTCAATTTTTTAAAAATTGTTTTTATATTTG