Transcript asmbl_25338

Sequence
Transcript Sequence for observation asmbl_25338 of TGE0000830:
GCGGAACCGGAGCTCCGGGCGGCGTCGGCAGCGGCGCGAGAGGCGACGAGGCCCGGGCGGCAGGAGCCGGCGCGGCGACCGCGGCGAGGGCGGCGGGGACGGAGCAGAGCACGACGAAGACGCACAGGCAGCCGGGCCGGGCCGGGCCACGGGGAGAGCGGCCGGCGGGCAGCGGGCGGGAGGCCGGGCGGGCCGCGGGCAGCCACCGAGCCGCGAAGCGACATGGTGCTGCTCAAGGAGTATCGAGTAATCCTGCCTGTGTCTGTAGATGAGTATCAAGTGGGGCAGCTGTATTCTGTGGCTGAGGCCAGTAAAAATGAAACGGGTGGTGGCGAAGGCGTGGAGGTCCTGGTGAATGAGCCCTACGAGAAGGACGGTGAGAAAGGCCAGTACACACACAAGATCTACCACCTGCAGAGCAAAGTACCCACGTTTGTTCGAATGCTGGCCCCAGAGGGAGCCCTGAATATACACGAGAAAGCCTGGAATGCTTACCCCTACTGCAGAACCGTTATTACAAATGAGTACATGAAAGAAGACTTTCTGATTAAAATTGAAACCTGGCACAAACCAGATCTTGGCACGCAGGAGAATGTGCATAAGCTGGAGCCTGAGGCGTGGAAACACGTGGAAGCCGTATATATAGACATTGCAGATCGAAGCCAAGTGCTCAGCAAGGATTACAAGGCAGAGGAAGACCCAGCAAAATTTAAATCTATCAAAACAGGCCGAGGACCCTTGGGCCCCAATTGGAAGCAAGAGCTTGTAAACCAGAAGGACTGCCCATATATGTGTGCATACAAACTGGTGACCGTCAAGTTCAAGTGGTGGGGCCTGCAGAACAAAGTGGAGAACTTCATCCATAAGCAAGAGAGGCGTCTGTTTACAAACTTCCACAGGCAGCTGTTCTGTTGGCTCGATAAGTGGGTTGACCTGACCATGGACGACATTCGAAGGATGGAAGAAGAGACGAAGAGACAGCTGGATGAAATGAGACAAAAGGACCCAGTGAAAGGAATGACAGCAGATGACTAAAGCCGCCTTTCCCCTCTGCACTTTTTGCAAGACAGTGGTCAACAGGAAGACCCAGCAGCTCCACCCTCCCAAGTGACAGGCCATTTTCGGACGCAGCCGTTCTGTGCCCATTCTTCAGGCAACTTTCGATTCCTTACTGTAGCTAATTCTAGATGCCCTTCAGTATTGTGAACAAATAGACCGTCTGGTGTCACAGAGCCCGCGTGTGCAGGAGCCTGCTCCTCCGAGATACGTGGCGTGTAGGTTGCTGTAGTTACAGCGCCTCCGTCTCTCTCCATTGTGTTCCGATCCATTTCTGTGTGTTCCCCCAACCTTTATTTCCAAGTGACATTTTCAGTCTTTCAAATAGCTGCCTTTTGTGATGTGGTGATTTAAATGATTTAAGTTCATTTGTTCTCAACCTTGGGGTAAACTGAGGTATTTTGCTTCCTGGGAAGATCTTCGCAATTTTGAGTGCTCCTGTGGGGAGCGGGGATGAGCTAAAGATACAATGTTTCCCTGCCCCGCACCGCTTCCACAAAATAGCAATGTGGTTTTGCAGCTCTGACTTCTGCTCCCAGTAACCCATCGTTAGGGCACTCTAGCACTATGGAGGTACCCAAGGCTCAGCCAGTCTCTATTTAAGAAAATTTAACAAATACGAGTAACCCTGTCCCAATCACTGAATCTCTAGTTACTACTCTTAGAAACACCTGTGGCTTCTTGGCCCTCCTGTTGCCCGCTCTGAATCTCTCTGCAGTCTACAAAATCGCCCCAGTCAACTCTCCACTTGGAGGGAATTGTCCAGTGTGGCCCCTAGAATTGAGTCACCCCCTAGATACCAACTGTCTGACCCCGAGGAGCTCTGTAAGTCCCTGCTCCTCCTCTTCCCTTTGGGGCTGGTGCTGCCACTCAGCAATAATCCTCTTTTCTCTGTGCTTTCTTAGGTCCCTG