Transcript asmbl_12873

Sequence
Transcript Sequence for observation asmbl_12873 of TGE0008071:
CCCATCCTTGCCTCAGCTTCGACCCCAGCCTCTGTCCCCATCCTGACCTCAGCCTCAATTCCCATCCTTGCTTCAGCCCTGGCACCAACTTCAGCTCCAGCTCCAGCCAACTCATCCCCGACCGCCCCAGCCAACTCAACCCCAACTGCCCCAGCCAGTTCAGCCCCAGTCCCAACTCCAGCCTCACTCCCAGCCCAAGCCCCACTCCCAGCCCCGTCTCCAGCCCTAGTCAGTGTCCCAGGTCCCACCGCCTCAGCCCAAACTCAGGGACAGACTCACAAACCAGTCCAGAGTCCACTACAGACTTCAGCACAGCCTCCAAAACAGCCACCACCTTCAATTAGACTACCTTCAGCCCAGACACCTAATGGCACAGATTATGTAGCCACAGGAAAGGCCATCCAGACCTCACAGTCACATGGCACTCTAGCAACTGAACTGTGGGATAACAAGGTGGCCCCACCAACTGTGCTGAATGACATCTCAAAGAAATTAGGTCCCATTAGCCCACCACAGCCGCCTTCGGTCAGTGCCTGGAACAAGCCTCTAACGTCGTTTGGATCAGCTGCTTCATCAGAGGGAACAAAGAATGGTCAAGAAAGTGGAGTTGAAATTGGAATTGACACAATTCAGTTTGGTGCTCCAGCTTCAAACGGGAATGAAAACGAAATTGTTCCTGTGCTTTCAGAAAAAACTACTGACAAAATACCCGAACCTAAAGAACAACGGCAGAAGCAGCCACGGGCAGGCCCTATCAAAGCCCAGAAGCTTCCGGATTTGAGTCCAGTAGAAAACAAAGAGCATAAACCTGGTCCTATTGGAAAGGAACGATCATTAAAAAATAGAAAAGTAAAAGATGCCCAACAAGTGGAACCGGAAGGACAAGAGAAACCAAGCCCCACTGTCGTCAGAAGTGCAGATCCTGTGACAGCAAAGGAAACCAAAGCAGCTTCCGAAATGTCTGCTGAGATAGGAACAATGATCTCGGTGTCATCTGCAGAGTATGGCGCTAACGTGAAGATGGAGTCTGCGCGTAAGGCGTGGGAAAATTCTCCCAACGTGAGGGAGAAGGGCTCTCCGGTGGCCTCTGCAGCGCCCCCCGTCGCCAGCGGCGTCAGCAGCGGCGCCAGCGGCCCGGGCACGGCCAGTTACAGCTCATTCTCCAGCGCGTCGGTGCCGCAGATCCCCGTCGCTTCGGTCACTCCTACGACATCGCTGTCAGGTGCTGGTACATACACTACCTCTTCTCTGAGTACAAAGTCCACAACCACGTCAGACCCGCCTAACATCTGTAAAGTGAAGCCCCAGCAGTTGCAGACAGGCAGCCTGCCCTCCGCCAGCCACTTCTCGCAGCTGAGCTGTGTGCCCTCCCTGATGGCCCAGCAGCAGCAGAGCCCACAAGTCTACGTGTCGCAGTCGGCAGCAGCTCAGATCCCAGCTTTCTACATGGACACCAGTCATTTATTCAATACCCAGCATGCACGATTGGCTCCACCATCGTTGGCCCAGCAACAAGGCTTCCAGCCAGGTCTTTCTCAGCCAGCTTCAGTTCAGCAGATCCCCATCCCTATCTACGCGCCGCTGCAAGGACAGCATCAGGCCCAGCTGAGCCTGGGCGCCGGACCGGCCGTCTCCCAGGCCCAGGAGTTATTCGGCTCGTCCCTCCAACCGTATAGATCTCAGCCAGCCTTCATGCAGAGCAGCCTGTCCCAGCCGTCTGTGGTCCTCTCTGGCACCGCCATCCACAGTTTCCCAGCTGTCCAGCACCAGGAACTTGCCAAGGCGCAGTCGGGCCTTGCCTTTCAGCAGACTTCAAATACTCAGCCCATTCCTATACTGTATGAACATCAGCTAGGCCAGGCATCGGGCCTGGGAGGGTCCCAGCTCATCGACACACATCTCCTCCAGGCTAGAGCAAATCTTACCCAGGCTTCAAATCTTTATTCCGGACAAGTACAGCAGCCTGGTCAGACAAATTTTTATAACACTGCCCAGTCACCGAGTACTCTCCAGCAGGT