Transcript asmbl_12754

Sequence
Transcript Sequence for observation asmbl_12754 of TGE0003645:
ACGGCTTGACAGAGCGCGGAGGAAAAATCCGCGAGAAGGTGGTGGAAGAAGATGGCGGTGCTAGGGCCGAGTTTACAATCTTTTTGAATAGACTAGTCCAGTAACTGTTCGGGTCATGGCGTCAAACTCAACTAAGTCTTTCCTGGCAGATGCAGGCTATGGAGAACAGGAGCTGGATGCTAACTCTGCCCTTATGGAATTAGACAAAGGTCTGAGATCTGGCAAACTTGGTGAACAGTGTGAAGCAGTTGTTCGCTTTCCCAGGCTCTTTCAGAAGTATCCATTCCCTATTCTCATCAATTCTGCATTCCTAAAGTTAGCTGATGTTTTCAGAGTTGGAAACAATTTCCTGAGGCTCTGTGTTCTTAAAGTTACTCAACAAAGTGAGAAGCATTTGGAGAAAATTCTAAATGTGGATGAATTTGTGAAGAGAATTTTCTCTGTGATTCATAGTAATGATCCTGTAGCAAGAGCCATCACACTCCGCATGTTGGGAAGTCTGGCATCAATAATTCCTGAAAGGAAGAATGCTCACCATAGTATTCGTCAGAGTCTGGATTCACATGATAACGTAGAAGTTGAAGCTGCTGTTTTTGCTGCTGCAAACTTCTCTGCACAGTCAAAGGATTTTGCTGTAGGAATCTGTAACAAAATCAGTGAAATGATTCAAGGCTTAGCCACACCAGTAGACTTGAAGCTAAAGTTGATCCCAATCCTACAGCACATGCACCACGATGCGATCCTGGCTTCCAGCGCTCGTCAGCTGTTACAACAGCTAGTCACGTCCTATCCTTCTACCAAAATGGTGATTGTTTCTTTGCACACTTTTACTCTGCTTGCAGCTTCATCTTTGGTGGATACACCTAAGCAGATTCAGCTTCTCTTACAGTATTTGAAGACTGACCCCAGGAAAGCAGTAAAGAGACTTGCTATTCAAGATCTGAAATTACTTGCCAATAAAACACCGCATACTTGGACTAGGGAAAACATTCAGGCACTCTGTGAATGTGCCCTCCAGACTCCTTATGACAGCTTAAAACTCGGGATGTTGTCTGTCCTTTCCACACTGTCAGGGACTATCGCTGTCAAACATTACTTCAGCATAGCTTCGGGAAATGTGGGTTCTTCGCCTAGATCCTCTGATTTAGTCAAATTAGCCCAAGAGTGCTGTTACCATAATAACAGGGGCATTGCAGCTCATGGAGTCAGAGTACTAACTAATATAACTGTTTCTTGTCAAGAAAAAGACCTTTTGGCACTGGAACAAGATGCTGTTTTTGGCCTGGAAGCCCTTCTGATACTTTGTAGTCAAGACGATAGTCCAGGTGCTCAAGCCACTTTAAAGATTGCTCTGAACTGTATGGTGAAGCTGGCCAAGGGCAGACCCCATCTTAGCCAGTCAGTGGTTGAGACCTTGTTGACTCAGTTGCACAGTGCTCAGGATGCTGCCCGGATCCTGATGTGCCATTGCCTGGCTGCCATTGCCATGCAGCTGCCGGTGCTGGGTGATGGAATGCTGGGTGACCTCGTGGAACTCTACAAGGTGATTGGACGATCAGCCACAGACAAGCAGCAGGAACTTCTGGTGAGTTTGGCCACTGTGATTTTTGTCGCCAGTCAGAAAGCACTCTCTCCTGAGGTAAAGGCAGTAATTAAACAGCAGCTCGAAAGTGTCTCCAATGGGTGGACTGTGTACCGAATCGCCAGACAGGCATCCAGAATGGGTAATCATGACATGGCCAAAGAGCTTTATCAGAGTTTGCTGACTCAGGTTGCCTCAGAACATTTCTACTTCTGGCTGAATAGTTTGAAGGAGTTCTCACATGCAGAACAGTGTCTCACTGGATTGCAAAAGGAAAATTATAGTTCAGCACTTTCTTGCATTGCTGAGTCTTTAAAATTCTACCACAAAGGGATTGCATCCCTAACGGCTGCCAGTACACCACTGAATCCTTTAAGTTTTCAGTGTGAATTTGTAAAACTCAGGATTGACCTTCTACAAGCCTTCTCGCAACTTATCTGTACTTGTAATAGCCTAAAGACAAGCCCCCCACCTGCAATTGCCACAACAATTGCCATGACCTTAGGGAATGACCTTCAGAGGTGTGGTCGCATCTCCAATCAGATGAAACAGTCCATGGAAGAATTCCGAAGCCTTGCTTCCCGATATGGAGATCTTTATCAGGCATCTTTTGATGCCGATTCAGCAACTTTGAGAAATGTAGAGCTACAGCAGCAGAGCTGTTTGCTGATATCTCACGCAATAGAAGCTCTGATTTTGGACCCGGAATCTGCAAGTTTCCAGGAATATGGATCTACTGGAACAGCCCATGCTGATAGTGAATATGAGAGAAGAATGATGTCTGTGTATAATCATGTCTTGGAGGAGGTGGAATCACTCAATCGGAAATATACCCCTGTTTCTTATATGCATACAGCATGCCTCTGCAATGCCATCATTGCTTTGCTGAAAGTTCCTCTTTCATTTCAGAGATATTTTTTCCAGAAACTGCAGTCTACCAGCATTAAGCTTGCTCTGTCACCATCCCCACGGAACCCTGCAGAGCCCATCGCTGTCCAAAATAACCAGCAGCTGGCGCTGAAGGTGGAGGGAGTGGTTCAGCATGGATCCAAACCAGGACTTTTTCGCAAAATTCAGTCTGTCTGTCTGAATGTTTCTTCCACGCTACAGAGTAAATCTGGACAAGACTACAAGATACCCATCGACAATATGACCAATGAGATGGAGCAGAGGGTTGAGCCTCATAATGATTACTTTAGTACTCAGTTTCTGTTGAACTTTGCTATCCTTGGAACACACAATATTACAGTGGAATCTTCAGTGAAAGACGCCAATGGTATTGTATGGAAGACTGGTCCCAGAACTACCATATTTGTCAAATCCCTGGAAGACCCTTATTCCCAGCAAATCCGCCTACAACAGCAGCAAGCCCAGCAGCCATTACAACAGCAGCAGCAACGGAATGCCTACACGCGATTTTAGCCACGTGACGAGTGTACTACAGGCTTTACAGGAATCGATGAAATTGTCAAAAATAGTTTGCTTTTCCACATGGATTAAGATATGAAAGTTTTAACGCAGACTCTGTTTACTCATTGGTTTCTGCAATGTAATCTGAAAAATGATTTTTTTTACCTTAAAAATTTCATTCGAGAGATATTTGGGTTACTAACCAGAAAGATTTTTTTCCCTTGTTCCTTTAACCAAGTCCTTTATCTCATATTTAACATTTTCATTCTTTTATTAGTGTTTTTACTGCTGCTGAGCCTTTTCTTTTTCTTTCAAGAAAAGTCACATATTGGGATCACTGAATTAGTAAATTTGACTGTTTCTCTACCAAAATATACTACTTGCTGCTTGACACAGGCCTGTAATTCTGAGCTATGCCTTGGGGAGTTCTGACCAGTAGGGTACAGGGTTCACCCGTAGTAGAAGAAACTGAGTCTTCCCGTGGGTGGACTTAGAAATGTCCCCTGAAACGTCCAGTTTCTGGGTTACGAGAGCAGGCAGTCTAGCAGAATTGAGACATCCTGCTATACATATTATTTCAACTACTTACCTATCTGTTCTGTGCTAAAGCAATCTTAATTTATTGTTTTAGTATTTAATTGACCCAAAGAGCAGCTAGCAATTACATAGGAAGATTTGGAGATTAATAATTTTTTTTTTATTATGCGTGTGATTGTGTAGACTTTGTACATTGTTTCTAAGAGTGAAAAAAATCACTCACATTTAATATCTTATTGTTTTAAGGTAGGAGGGCAGATCTTTTCCTTTGATTGATTTAGTTTCTTCTTGGCAAGTTCTGTAACGCTAGACTTGATTGTCTAGAAAGGACCGTCTCCTTATAACCAACCTCAATTAGTTGAGATGCTCAGGGAATAGAAGTTTTCTGGTTAGCCAGAAAACTCCTTTTTTCTATTTCAATACTGGCTGAAAACCATTGTAAAATCTAATAATAGTATGCTTTCTTGTCTTAACACAGTGCAGTAGATAAAATTTAACTATTCTTTCTTGATTTGGGATCAGTCAGTGCTTTGGGATCATGATTTCTAAACATCAGGGATCACAGATTGCAGATATCGATGATATGGTCACTTAGGCTGGAATCAGCTCTGAATGTGAAGCAGACACATTCCTTGGAAGTTTCTTTTTAAAATAAATCTC