Transcript asmbl_35712

Sequence
Transcript Sequence for observation asmbl_35712 of TGE0002736:
CGGATGCGCACGTGCTTTATAAGCGCCCGGCGCCGTCCGGCCCCTCCTTTCTGAGCCCCGGCGGTGCGCGCTACGGAGCTCGGCCAGCCTGCTCCGTCCTGACTCACCGCTGTTCGCTCCTGCTGAGGAACAAGTCGGTCAGGAAGCCGCGCCTCAGCCATGGCATTTAAAGATACCGGAAAGACGCCCGTGGAGCCCGAAGTGGCGATTCACCGAATTCGAATCACGCTCACCAGCCGCAACGTGAAGTCGCTGGAGAAGGTTTGTGCGGACTTGATCAGAGGCGCCAAGGAAAAGAATCTGAAAGTGAAAGGACCGGTGCGCATGCCTACCAAGACTTTGAGAATCACTACCAGAAAAACACCTTGTGGTGAAGGTTCCAAGACCTGGGATCGATTCCAGATGAGGATCCACAAGCGACTCATTGATTTACATAGTCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCGGGAGTTGAGGTTGAAGTCACCATTGCAGATGCCTAAGACAACTGAATAAATCGTCTTAATGGTCAAA