Transcript asmbl_3492

Sequence
Transcript Sequence for observation asmbl_3492 of TGE0003685:
GGAAGTGAGTCGGACCGGGCTGGGCTCGCTAAAGGAGAGGCACCGCGGAGGGGCAGGCCAGCGTCGCGTCGCGATCCGGGATGTCGAAGAACACGGTGTCGTCGGCCCGCTTCCGGAAGGTGGACGTGGACGAATATGACGAGAACAAGTTCGTGGACGAGGAGGACGGCGGCGATGGCCAGGCCGGGCCCGACGAGGGCGAGGTGGACTCGTGCCTACGGCAAGGAAACATGACAGCTGCTCTCCAGGCTGCTCTGAAAAACCCCCCTATTAACACAAAGAGCCAGGCAGTGAAGGACCGTGCAGGCAGCATCGTCTTGAAGGTGCTTATCTCTTTTAAAGCTAATGATATTGAAAAGGCAGTGCAGTCTCTGGACAAGAACGGTGTGGACCTCCTAATGAAGTATATTTATAAAGGCTTTGAGAGCCCATCTGACAACAGCAGTGCTGTGTTGCTCCAGTGGCATGAAAAGGCCCTTGCTGCTGGAGGAGTGGGGTCCATTGTTCGAGTTTTGACTGCAAGGAAAACCGTGTAGTCCAGCTGGAACTGGACACCGTTCACAGAAGTGGGAGTTGCTGGTATAAAGACCAAAACAACCAAATGGCACCGCTGCCCTGTGGGTAGCATCTGTTTCTCTCAGCTTTGCCTTCTTGCTTCCTTTTTCATATCTGTAAAGAAGAAAATTACATATCAGTTTCCTTTAATGAAAATTGAAATAATGTGGAGAAAATTTTGTCTCAGTGGGGATGTTTGACCCTTTCATAACCATGTCAATAATATGTATCACATTCTGTAATTTATATTCAAGTTTGATTGTGCAATTTCTAACTCTGTTGCCTGGTTTAAGGGTTTTACTTTATTTTTAACCAATACTGAGAGATGTGATCAAAGTTGAGGCCAGTTTCCTAACTCATTGCTGGTCAGGAAGTGATCTTTATTTTTAAAAATGAGAGACTGGCAGCTATTAACATTGCAAAACTGGACCACACTTCCCTTATTTAAGCAAAATGTGTTTCCAGGGCAAGTAGTGGGTGAGCCCTACTACCAGTTTCCAGCCTTCTTTCCGCTTGCCTCCAGATGATGCTATAAGTGTAAGTGTGCTACTTCCTGTTAGCATCCAACTTTCATGGCCTCTCAATCTCTTTGTGGTGACCCAGGGTCCGGAGCAAGGAGTCTTGCTCTATATAAATGTATTTACACAATATAAGCGCCTCTTTGGCACAAACATCCCATTTCCTTCTGGTAATAAGGCTGCCTGGGGAAACAGTCCCAAGTCAGAGACAGGCCTCCAGCAGCCTCTGGATGAAATACTTTCATCAGAAATAAGGTAGCTGCCTTAGCCATTACACAAGTGTTCACTGGAACATTTCCCATGATTTCCCGAGGACGTCTTCAGTGTTCTTCAGGTAATGGGGATCTCAGAAGATTTGGTTCTGATCCAAAGACACAGTCTGTGTTTCAGCTCAGTGTTTTTAAGAAAGAAAAATGCCACATAGTAAAAGAAAAAAAGTGTTTACTTCGTTGGACAAACCAAATTGATTCTCAAAAAATGACCGGTGCTTGTAAAAAGTTATTACAAAGTAGTTCCGAAACCAACCACCTGAATGTGCGTGGCCGAGAGGGAATCAGCCTGCTTGTCTTTCCCTAAGATGCCAACTCCAGAGTCACTGACTGAGGTGAGAACCAGCGCAGAAACTCTATAAACTGCTGTTTTTGATACCTGCTCTTTTTGTTTTGTTCTGTTTTGTAAAATTATGATAAACTTCAGAAAATAAAATGTCAGTGTTGAATAA