Transcript asmbl_33349

Sequence
Transcript Sequence for observation asmbl_33349 of TGE0054568:
CACGCGCAGACGGCTGCAGGGTCCTTGGTGCTGTGGCGGTGTGGTTGATTAGGGTGCTGCTTTCAATCGTGTGGCCTTTGGGAACCCCGCGTAGCCACTGCCGCCTCCTTCTGTCCTCGCCATGTTCCTCACTCGGTCCGAGTACGACAGGGGTGTGAATACTTTTTCTCCTGAAGGAAGATTATTTCAAGTGGAATATGCCATTGAGGCTATCAAGCTTGGTTCTACAGCCATTGGCATCCAGACCTCAGAGGGTGTATGTCTAGCTGTGGAGAAGAGAATTACCTCCCCACTAATGGAGCCTAGCAGCATTGAGAAGATTGTAGAGATCGATGCTCATATAGGTTGTGCCATGAGTGGGCTAATTGCTGATGCTAAAACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACCTATAATGAGACAATGACAGTTGAGAGTGTGACCCAGGCTGTGTCCAATCTGGCTCTGCAGTTTGGAGAAGAAGATGCAGATCCAGGTGCTATGTCTCGTCCCTTTGGAGTAGCATTGTTGTTTGGAGGAGTTGATGAGAAAGGACCCCAACTGTAAGTACCATTTCCCACCCCTGCTTTGGGATGGCAGGGCAGGTGGATCTACGTGAGTTCGATTCCAGCCAGGGCTACACGGAGAAACTTTGTTCAAAAAACCAACC