Transcript asmbl_12388

Sequence
Transcript Sequence for observation asmbl_12388 of TGE0003620:
GGAGGAAGGGCAGGAGGAAGGGGTGCGGTCGCAGTCGCGGTCACGGTCGCGGGCCGGGAACGAGCTCCGAACACCAGCCCGCGAGGCCGCACACCTGTCTGGCTGTTCTGCCGCACACCAGTCCCCGCAGCCTCGCTTCAGGGTTAGTGTGACCTGAACTTAAGGCAAAGGTGGTATATCATGGCATCTCTCTGGGTTGGACACCGAGGGACAGTGCGAGATTATCCAGGCTGTAGCCCATCAGTGGATGCTGAAGCGATTCGTAAGGCAATCAGAGGAATTGGAACTGACGAGAAAACACTCATCAGCATTCTAACTGAGAGGTCAAACGCACAGCGGCAGCTGATTGTTAAGGAATATCAAGCAGCGTATGACAAGGAACTGAAAAATGACTTGAAGGGCGACCTCTCTGGCCACTTTGAGCATCTCATGGTGGCCCTCGTGACTCCTCCAGCAGTGTTTGATGCGAAGCAGCTGAAGAAATCCATGAAGGGCACTGGAACAAATGAAGATGCATTGATTGAAATCTTAACCACCAGGACAAGCAGGCAGATGAAAGAGATCTCTCAAGCCTACTACACAGTATATAAGAAGAGTCTTGGAGATGACATTAGTTCTGAAACATCTGGTGACTTCCGGAAAGCTCTGTTGACTTTGGCAGATGGCAGAAGAGATGAAAGTCTGAAAGTAGATGAGCATTTGGCCAAAAAAGATGCCCAGATTCTCTATAATGCTGGTGAGAACAGATGGGGCACGGACGAAGATAAATTCACTGAGATCCTATGTTTAAGGAGCTTTCCTCAACTAAAACTAACATTTGATGAATACAGAAATATTAGCCAGAAGGACATTGAGGACAGCATAAAAGGAGAATTATCTGGGCATTTTGAAGATTTGCTGCTGGCCATAGTTCATTGTGCAAGGAATATGCCTGCCTTTTTAGCTGAAAGACTACATCAAGCTTTGAAGGGTGCTGGAACTGATGAGTTCACTCTGAACCGAATAATGGTTTCCAGATCAGAAATTGACCTTTTGGACATTCGAGCAGAGTTTAAGAAGCAGTATGGCTACTCCCTAAATTCAGCAATTAAATCGGATACTTCTGGAGACTATGAAATCACACTCTTAAAGATCTGTGGAGGAGATGACTGAGTCAAGAACATCATCTCCAAAGGTTGTTTGCTTCCATGATGGGCTTCTCCAACAGCTCTGCTTACTTCTCTTTCACGGGATTTAAAAGTACAAGAAGTATAAACAGCAATCTGTTTTTCGTAACAGAAATTGTCATTGTTCCATAACAACAACAAAGTGATTATCTTAAAGTATTTCATCATAATGTAGTAGTTTATAAGTGAAAATTTAAAATGGTATAAAGAATCCGCTAATACTCTCCAAATTATATTTCTACTTAGGAAGTGAGAATCATTGTACAGTTCTAAAACATTAAATGCAAAAACAAGGTAATAAAAGTTGTCACCTTTGTTAAA