Transcript asmbl_12076

Sequence
Transcript Sequence for observation asmbl_12076 of TGE0003610:
GGCGAGGTCGACAGGGCAAAGGACTCAGGTGCAGGCTTCCCTAACGGACTAGTCTCGCACCTAAAGAAGAAAGAAAATGGCCTGTGCCGAGTATTCTTTTCATGTGCCGAGTCTAGAGGAGCTTGCTGGAGTTCTACAGAAGGGACTAAAGGATAACTTTGCTGACGTCCAGGTTTCTGTAGTTGATTGCCCTGATTTGACTAAAGAGCCATTTACCTTTCCTGTGAAAGGCATCTGTGGGAAAACTAGAATTGCAGAAGTAGGAGGTGTGCCTTACTTATTGCCTCTTGTAAATAGAAACAAAGTCTATGATCTAAATAAGATTGCAAAAGAAATCAAGCTTCCTGGAGCTTTTATTCTTGGAGCGGGGGCAGGCCCATTTCAGACTCTCGGGTTCAATGCTGAGTTTATGCCAATTGTTCAAACAGAAAGTGAACACAAACCTCCTGTGAATGGAAGTTACTTTGCCCGTGTTAACCCTGCAGATGGAGGATGCTTACTAGAGAAATACAGTGAGAAATATCGTGATTTTGGGTGTGCATTACTGGCTAATCTTTTTGCCAGTGAGGGCCAACATGGAAAGGTCATTGAGGTGAAAGCCAAAAGAAGAACTGGAAAACTTAACTTTGTGACTTGTATGAGACAGACTCTTGAAAAACATTATGGAGATAAGGCTGTAGGGATGGGAGGTACTTTCGTAATTCAGAAGGGAAAAGTGAAGACTCACATTATGCCTGCAGAATTTCCTTCCTGCCCTTTGAACTCTGAGGAAAAGGTGAATGAATGGTTGAATTTTTATGAGATGAAGGCTCCTTTGATTTGTCTGCCAGTTTTTGTCTCCAAAGACCCAGGATTTGATTTGCGATTGGAGCACACTCACTTTTTCAGTCATCATGGAGAAGGTGGACACTACCATTATGACATTACCCCAGATATAGTAGAATATCTTGGCTACTTCTTACCTGCGGAGTTTCTTTATCGCATTGATCAACCAGAAGAGACCCATTCATATGGGCGAGATTAAATCAACTGATCAGCATTTAGAAAAAGAAGTGATTAACTAAAGTTAATTAAATGATTAACTCATTAATTGCTACAAATATAAAGTTCAATAGAAATGATCTTACTACTTAAACCCTATTTTTTTGGCCTTTGAAATGAAAGGTATGTTGACATTACTCTGTTATTTCATAGATCTGAAAAAGTTTCTTGGGAACAAAGATATATAATGGAGATGTTCTTCATTATTTTTTTATTCTAAAAATCAGTCTTATATTTATACCTTAAATATAAACATGATCTGGAATCATGTGATTGGTTAATTTTACTAACAGTAATAATTTACACTTAACATTATTAATTTTTTCAAATTAGTCTCACAACTGCTAATTGGGTATTTCTGGGTACTAGAAAAATCAGTGTTGGAAATTTTGATAGTTGTTGAATCTTTGTATTGAATTTTAAAAGTCTATTTTAGGAGTCAGAGTACACTTTTTTCATGGAATAAGGTGATCAGAAGGAGCAACTTTACCCCTTTTGGTGAAGTTGAACCATACTCAGAGTTTGCAGTTTGCCTTGTACAAACATTAGCAACTAGACAGTTAGCCATGATTCCTCTTTTGTTTGGATCGCCAACTGGAAGCAGTTTGTACCTTATTAGTTATTTGGAAGAAGAAAGCGGGGAAAAGAAACAGCATCAAAATACAACACTGAAGTGAGTATAATTTCTAAGTGAGGCTGTTGTTACACATGACCACTGTCCTTTGTGAAATATAAAATTATATTTGAATACATTTGTTACTGGTTATAATGGTTGAAATTTTCTTCAGTGTTCTTCTGTAATAATCATTAGTAAGAAATCAACTGTAATCTTATTAATGCCAACAATGTGCAGATTTAGGAGCTCTTCAGTACTAAGCACATAATAAATCAAAAAATATTATTTGATTGTCTTCTCTGGATGTAAGCTATAACATATCCTTTGAGTATAAATTTTAAAATATTTTTAAATAAGTACTAGTTTG