Transcript asmbl_11685

Sequence
Transcript Sequence for observation asmbl_11685 of TGE0003598:
CGGGGCGCGGCCGAGGTCCCCAGACCAGAACTGGAGAGGATATTCGGGATCCCTACTCCGCTAGTGGAGAAAGGACCTGCCTCCCACGCACCCTCACCTAACCAGAGCGGGGATTTCTATGGCCCCTCCTGCTGGCTTTTTGAAGAAAGCGAAAGTGAAAGAGGGAAGAAGACTGAGGAGATCGCGGCGCCATGAAGCACCTGTCCCTGCTCCTCGCTCTGGCTTTGGGCTTGGTGACCGCCGTCTCGGCGGGACCCACGGTGATAGAATGCTGGTTCGTGGAGGATGCAGACGGGGGCCGCCTGGCCAAGAAACCCGCTGCATTGCTGCTGCGCCAGGGCCCAGGGAGAATACCTCCCCGGCCGGACCTCGACCCCAAGCGCTACCTCAGAGTACATGACCCCACAGGCACCCTGCAGGCTGCCTTCAGGCGGTACCCCCGGAGCGCCCCCACGCCACACTGCGAGATGAGCCATTACATCCCACTCCCCGCCTCTGTGAATTGGGTCAAAGGCCTGACTCCGGAGCAGAGCTGCCCGCGGGCCTTGGACGGGACTTGGTTCATGGTCAGCATGTCCAGCCCGGTCCTCAGCCTCTCCAGCCTCCTACAATCACAGACCGAGCCTCAGCCAGATCCTGGACTCATCACCATGGCAACAGCTGTGCTGACTGTCATCACCCACAACCCCACCACTAGAATCCAGCTGGGACAAGATGCTCTGCTGGACTTGAGCTTTGCTTACATGCCCTCCACCCCAGAGGCCACTACACCTCTGGCCCCAGGTCCCCCTCCCTTTGGGCTGGAGTGGCGACACCAGCACCTAGGGGAGGGGCACCTGCTCCTGGCTGCAACTCCTGGGCTGCGTGGGCAAATGCCAGCTGCCCGAGATGGGGCAGTGGCATTTGCCGCTTGGGATGATGATGAGTCATGGGGTCCATGGACTGGAAATGGGACCCTCTGGCTGCCTGCAGTGAAGCCTTCCCAGGAGGGTGCCTATCAGGCCACCATATACCTGCCATATCTGCAAGGACAGGTCACCCTGGAGCTTGCTGTGCAGAAATCCCCCAAAGTGTCCCTGATGCCATCACCTCTTGTATGGGCTGCCCCTGGGGAGGCACCCCCTGAGCTAGTTTGCCTTGTGTCCCACTTCTACCCCTCTGAGGGCCTGGAGGTGGAGTGGGAGCTCCGAGGTGGTCCAGAGGGGAGCTTTCAGAAGGCCAAGGGGCAGAGTTGGCTCTCAGCCCTGCACCACCACTTGGATGGCTCTGTCAGCCTCTCTGGGCACCTGCAGCCATCCCCGGTCACCACTGCACAGCACGGGGCGCGCTATGCCTGTCGTGTCCACCACCCCAGCCTACCCGCATTGGGGCGCAGTGCTGAAGTCACCCTGGAGGTGGCAGGTCTCTCTGGCCCCTCCCTGGAGGATGGTATAGGCCTCTTCCTGTCTGCTTTTCTGCTCTTGGGGCTCTTCAAGGTACTGGGCTGGGCAGCTGCCTACCTGTCCACTTCCAAGGAATCAAAGAAGAAAGCACAGTGAGGGCACTCAAGACCACCCTGGGGAAGCTACCATCATCTCTGACCTGAACTACTGTAGTAGCTCCTCCAAACAGTATGCCATCACCTGCTCCTGCTCCTGCTCCTTCCAATCTCTCTCCACGGTGGGAATGCTTTTTTAAAAAAGACACAAATCTATAGCATTCACCTTCTTAGAGCTCTAAGGCTGTGGTTCTCAAAATTTTTGGTCTCAGGACATCATAAAAACGAAGGACTCTCGAGCTTTTGTTTATGTGGGTTATAAACTAACTATTTATCATACTAGAACTTAAAACTGAGAAAAGTTTAAAACAGAAGGATACACAGGCACACATTCCATTGGCTGTGAAGGAGATAATGTCAATACACATCATGTAGCTCTGGGAAATTTCACTGTACATTTTTTTAGAGAATGAAAGTGAAAAAGGCAAATAACATTTTAGTGTTATGAAAATAGTCTTAACTTCGTATGCGCAGTGAATTAGTCTCAGAGATCTCTGGGGCAGGGACCACACCAAGAGAACGGGTGCTCTAGAGGCCAAATCCATTCTTCTTGCCCTTGGCACATGAATTTACGGCGCTGGAGCCACTGCTTACCTCTTCAACCCAATCTGGTGCTCTCCAGCACTCTCAATACTCATCACACCTACAGCTCTTCCTTTCCTCCAATGGCCTCTCACCTTCCCTAGGTCCCAGAGTTCTGTTCTCTCTGCCTGGTCCACCCTCGCTCTCCCTGGGCTCCAGACCAGATCAGCCAAGTCATTCCCCTCAGACCGCCGCGTGTCCCTCTTGTGCGGTTCACCACGGTTGTACTTAAGTGATTGTGCGAGTTGTTAAAGCCCGTTTCCCGGACTCTCAGCTCCTCGCAGTTGCAAAAACAAGTCTGTATGTCCACTGCTTTATCTCCCGCATCGGCAGTGGGCCTGGCGCCCACTGGAGGGCGCTCGGTATAAGAAGTTATAGTCCTTTTTTTCATCCTAAGGATTCAAAAACAGGTATAGGGTCAAGTAACTACTGGACGAAGGAAGCGGCGACTTAAGGACCTCCGAGGGGCAGGACCGTGGGCCAGACCGACGCGGGGAGCGAGTCTACTCGGTGGGAATAAAGTTGTGTTCCAG