Transcript asmbl_11669

Sequence
Transcript Sequence for observation asmbl_11669 of TGE0003597:
GGACGGCAGCCGTGAAGGCGACGGTGGCGCAGGGCCGGGGACGGGGGGAATGAGGAGGCCGCGGCGGGCCAGCGGCGGAGCTGTGTAGCGGATAAGCGGCTCCCCCTCCTTCCCTTGGTTGAGTCGGGGGCGCGCGCGCGAGCGCGCGGCCGTCCGGAACGGGCTTCCCACCCTCCACTCCCGCGACCCGCACGGCACCCCCACCCGGGCCCGGAGGATGATGAAGCTCAAGTCGAACCAGACCCGCACTTATGACGGCGACGGCTACAAGAAGCGGGCCGCGTGCTTGTGTTTTCGCAGCGAGAGCGAGGAGGAGGTGCTACTTGTGAGCAGTAGTCGCCATCCCGACCGATGGATTGTCCCTGGAGGAGGAATGGAGCCAGAGGAGGAGCCAAGTGTGGCAGCAGTCCGTGAAGTCTGTGAGGAGGCTGGAGTAAAGGGGACATTGGGAAGATTAGTCGGGATTTTTGAGAACCAGGAAAGGAAGCACAGAACATATGTCTATGTGCTCATTGTCACGGAAGTGCTGGAAGACTGGGAAGATTCAGTTAACATTGGAAGGAAGAGGGAGTGGTTTAAAATAGAAGATGCCATAAAAGTGCTGCAGTATCACAAACCGGTGCAGGCGTCGTATTTTGAAACATTGAGGCAAGGCTACTCAGCCAACAATGGCACCCCGGTCGTGACCACCACATACTCAGTTTCTGCTCAGAGCTCTATGCCAGGCATCAGATGACTGAAGACTTCCTGTAAGAGAAATGGAAATTGGAAATTAGACTGAAGTGCAGATCTTCCCTCTCACTCTTGCTCTTTTCACCTCTCTTCACAGGCCTCCTCTTTCAAATAAGGCATGACGGGCAGCAGAGGAAGGGTTTATTGATAATGTTCCTGTTTGGTGTTAAGTGATGGGGCTTTTTCTTCTCGTTTTTTTTTGAGGGGGGTGGGGGTTGGGTATGTAATTTGTAAGTACTTTTGTGCATGATCTGTCCCTCCCTTTTCATACCTCTACAATTCTCTAAAAAGAGGCAGACAGCCTTCCCTTTGCCTTGGATTCTGAAGTATTCCTCTTTGTCTCATCCCATCCCTGGCCAGACATTTTTCTTTGATTTTTAATTTTTTTAAATTAAAAGCTACCAATATGAGATAAAAACTTTCAAGAATTTGTTCTGTAATGTGCTGTTCAGTCCAGTAGGTTGGTCAGTTTCACTGCAGAATACATTTATCTACACATTATATACTGGGCATATAATATGTAAATAAATGACTTTTAGAAGAAAAATTTAACAGTTTAAATTTTTTTCAAGGTTTTGTTTTGTTTTTTAAATTTGGGGTGTTTCTGAAATGGAGAGCCTCACAATTTACTTTTTAATTTTTCCTGCTAGTGTCTAGATAAGTCTTCCTGTCCTTTCTCTTTTCCCCAGTCATTGATGTAGTTATGTAAGGTAAGGGAAGAGTTTAGCTACCTTCCTAGTGCTCCCAGGACTCATAGCCTTCTCTTCGCAAGCTGTGTTTCCATGCCAAGAAAGAAACAGGAAGAAACCTATTTGCTTTTTTATTACCAAGCCAGGAGCAAATGGCCTCAGCTCAGATTTGGAGAAACAGTGATAGCAATTGAATTCCTCCCTTGTATGTTGACAATAGGGATTTGAACTGGATTCTTGGGATTACTATCTAAAAAACTGGAGCATCAAGCACTGTTTCTATCCTGCTAGTTTGGAATTTTTTCCATAATGCTACTTACTACCGACAACAGCCTCTCTCCTGTGCATACATGCCTTACAGTGTGCCGAACTAGATATTGTCCTTGTGCTCTGAAGCATCCAGGTGCATCTGTACAGTCCTGTCCCCATCCTGGGTAACCTTGTTAAGTTCCTGAAAAGTACACAGGAGGAAAGTTCAGGTGTTTGCTGATCTTCGTAATGTTATATAGCTCTTGTAATTGCACCATGGAGCATGCTCAGAAATACTGAATTTGTCTCCCACTGGGATGTGAAAGGTCCATCTTCTGCTGAGAAGTGATATGGGAGAAGCTTAATCATTTACTAGAACAGCTACATAATGCATTAGCTCACTGCAAACTGTCTTGTTGGTTTTTAGTACAGGTTTCATGTTGGTTTCATTTGCCAATTGAGTTGTTTAGTTGAGAAGTAAGTAGAAAAGGGTCTTGAGATCTGGGGCTGTGACTGGGAGTGGAGGAGACACTGATCATTCCCTGGCTTGGGACAGGAGTTTGTTGCTGTACTCTTAGTGGCATCTCCTTTGTCAAAACATAGCCAAGATGTGAAATTAGAATCGTAGTTCTCCTTATTTAAAAATTCTAATAAATACTCA