Transcript asmbl_28848

Sequence
Transcript Sequence for observation asmbl_28848 of TGE0006790:
TGACTGTGAGTACGGAGGAGCAGCGGCCGCCATTTCAGGGAGCTAGCCGACGCTGTCGCAGGGGTGGATCCTGAGCTGCCGAAGCCGCTGCCCTGCTCTCCGTCGCGGGCTCCTTTAATCCCATTGTTTCTTTTAGATTCGCTTGGGCCTAGACGCCCTCGGGGCCCGATATTCGGGTTGGGCGGTACCGCGGCCTGGGCCTAGTGGCTTAACAGTAGCGACAGCAGCAGCGGCGGCGGCGGCGGCAGCCGACTTCCCGTGGCGAGCACAGGCGCGCGGAAGCCCGCACAGGCGAGTAGAGAAAATGGCAGACGATATTGATATTGAAGCCATGCTTGAGGCCCCTTACAAGAAGACTTGCCTAACGATATCTCACCTCTACTCCCATGAATTCACCTTTGATTCCAGTGTGAACTGTCAATCATAAGGATGAGAACAAGTTGAACAGTGCTAACGGCCATGAAGAACGTAGCAAAAAGAGAAAAAAAAGCAAGAGCAGAAGTCGTAGTCATGAGAGAAAAAGAAGCAAAAGTAAAGAACGGAAAAGAAGTAGAGATAGAGAAAGGAAAAAGAGCAAAAGTCGAGAGCGGAAACGAAGTAGAAGCAAAGAAAGGAGACGAAGCCGCTCACGCAGTCGGGATAGAAGATTCCGAGGCCGCTACAGAAGTCCCTACTCCGGACCAAAATTTAACAGTGCCATCCGAGGAAAGATTGGATTGCCTCATAGCATCAAATTAAGCAGAAGACGTTCCCGAAGCAAAAGTCCATTTAGGAAAGACAAGAGCCCTGTGAGGGAACCTATTGATAATCTCACTCCTGAGGAAAGGGATGCAAGGACTGTTTTCTGCATGCAACTGGCAGCAAGAATTCGACCGAGAGATTTGGAAGAGTTTTTCTCTACAGTTGGAAAGGTTCGAGATGTGAGAATGATTTCTGATAGAAATTCAAGACGTTCCAAAGGAATTGCATATGTGGAATTTGTTGATGTCAGTTCAGTGCCTCTAGCAATTGGATTAACTGGCCAACGAGTTTTAGGAGTGCCAATCATAGTTCAGGCATCACAGGCAGAAAAAAACAGAGCTGCTGCAATGGCAAACAATTTACAAAAGGGAAGTGCTGGACCTATGAGGCTCTATGTAGGCTCATTACACTTTAACATAACTGAAGACATGCTTCGGGGGATCTTTGAACCTTTTGGAAGGATTGAAAGTATTCAGCTCATGATGGATAGTGAAACTGGCCGATCTAAGGGATATGGATTTATTACATTTTCTGACTCAGAATGTGCCAAAAAGGCTTTGGAACAACTGAATGGATTTGAGTTAGCTGGGAGACCAATGAAAGTTGGTCACGTTACTGAACGAACTGATGCTTCGAGTGCTAGTTCATTTTTGGACAGTGACGAACTAGAAAGGACTGGAATTGACTTGGGAACAACTGGACGTCTTCAGTTAATGGCAAGACTTGCGGAGGGTACCGGTTTGCAGATTCCACCTGCCGCACAACAAGCATTACAAATGAGTGGCTCTCTGGCATTTGGTGCTGTGGCAGATTTGCAAACACGACTTTCCCAACAGACCGAAGCCTCAGCTTTAGCTGCAGCTGCGTCTGTTCAACCTCTTGCAACACAGTGTTTCCAACTTTCTAACATGTTTAATCCTCAAACAGAAGAAGAAGTTGGATGGGATACAGAGATTAAAGATGATGTCATTGAAGAATGTAATAAACATGGAGGAGTCATTCATATTTATGTTGATAAAAATTCAGCTCAGGGCAATGTGTATGTGAAGTGCCCATCTATTGCTGCGGCTATTGCTGCTGTCAATGCATTGCATGGCAGATGGTTTGCTGGTAAAATGATAACAGCAGCGTATGTACCTCTTCCAACTTACCACAACCTCTTTCCTGATTCTATGACAGCAACACAACTACTGGTTCCAAGTAGACGATGAAGGAAGATACAGTCCCTTATGTATATAGCTTTTTTTTCTCTTGAGAATTCATCTTGAGTTATCTTTTATTTAGATAAAATAAAGAGGCAAGGGTCTACTGTCATTTGTATACAACTCCTGTTACCTTGAAAAATAAAAATGTTAACAGGAATGCAGTGTGCTCATTATCCCTAACTAGCAAATCCTACTTTATGCAAAGCTGTTCTCTTGTTCTGCTGTTTTAAATGTCCATGTAGAAAATGACATTAAGGATCTATAGAATAGCTCTAGGGGAACAAATGTGCTTTCTGTATAAAGGCAGACAGGTCACGTTTTAATGTTTCAGAAACCTAACTTTTTACACAGCAGTTACAATTCACATTCATGTATTTGGCTCATGGTTCAGCAAAGGTTTCCAGAATCCACATTTAGTGTGTGAAAAGTCTAAGTGGCTGTATGGCTGCTTGGCATTTGATCTTGATTATTTGGCAAGAATGGGATTTCAAAATAATATTTCTCGATGGTAATTTTTTCAATTAATGTCTCTGTAAAAGTTTCTTTGTAAATACTGTATGTTTTAGTGTGTCTTGAGATTCCAAACAAAATGATCCCTGCATTTCCTCAAGGTGGCTGACGTAACAGATTGAGTAAGCAGTCTTGGGCAAGAGATGGGAAATGCAGAAAAAGGTTTTGTCTGGTTGCATATAATCTTTGCTCTTTTTAAGCTCTGTGAGCTCTGAAATATATTTTTGGGTTACTTCAGTGTGTTTGACAAGACAGCTTGATATTTCTATCAAACAAATGACTTTCATATTGCAACAATCTTTGTAAGAACCACTCAAATAAAATTCTCTGAAAAAGGCCACAAGAAAA