Transcript asmbl_28846

Sequence
Transcript Sequence for observation asmbl_28846 of TGE0006790:
GCGAGATGTGTGACAGAGGTGGCATCAAGCTCTTACAGTCCCAACCCTCCAACGGAAATGGGCGAAGATCTCAGGAATGGCATCGGTCACAGGAAATCGATAGTGGCTGGCTGCTAGCATGGCCACTTGGGGCTTAGGCAGAAATAGAGCCATGGTACCGACAAAAGGGACAATAGCACATGGAATAAAACTCAAAATGACTTCATGTTTCATAGAAATCTTTAACCACTTCAACATTGTAATTCCGGATGACTTATTTAATACTTAAACAATGATGAGAACAAGTTGAACAGTGCTAACGGCCATGAAGAACGTAGCAAAAAGAGAAAAAAAAGCAAGAGCAGAAGTCGTAGTCATGAGAGAAAAAGAAGCAAAAGTAAAGAACGGAAAAGAAGTAGAGATAGAGAAAGGAAAAAGAGCAAAAGTCGAGAGCGGAAACGAAGTAGAAGCAAAGAAAGGAGACGAAGCCGCTCACGCAGTCGGGATAGAAGATTCCGAGGCCGCTACAGAAGTCCCTACTCCGGACCAAAATTTAACAGTGCCATCCGAGGAAAGATTGGATTGCCTCATAGCATCAAATTAAGCAGAAGACGTTCCCGAAGCAAAAGTCCATTTAGGAAAGACAAGAGCCCTGTGAGGGAACCTATTGATAATCTCACTCCTGAGGAAAGGGATGCAAGGACTGTTTTCTGCATGCAACTGGCAGCAAGAATTCGACCGAGAGATTTGGAAGAGTTTTTCTCTACAGTTGGAAAGGTTCGAGATGTGAGAATGATTTCTGATAGAAATTCAAGACGTTCCAAAGGAATTGCATATGTGGAATTTGTTGATGTCAGTTCAGTGCCTCTAGCAATTGGATTAACTGGCCAACGAGTTTTAGGAGTGCCAATCATAGTTCAGGCATCACAGGCAGAAAAAAACAGAGCTGCTGCAATGGCAAACAATTTACAAAAGGGAAGTGCTGGACCTATGAGGCTCTATGTAGGCTCATTACACTTTAACATAACTGAAGACATGCTTCGGGGGATCTTTGAACCTTTTGGAAGGATTGAAAGTATTCAGCTCATGATGGATAGTGAAACTGGCCGATCTAAGGGATATGGATTTATTACATTTTCTGACTCAGAATGTGCCAAAAAGGCTTTGGAACAACTGAATGGATTTGAGTTAGCTGGGAGACCAATGAAAGTTGGTCACGTTACTGAACGAACTGATGCTTCGAGTGCTAGTTCATTTTTGGACAGTGACGAACTAGAAAGGACTGGAATTGACTTGGGAACAACTGGACGTCTTCAGTTAATGGCAAGACTTGCGGAGGGTACCGGTTTGCAGATTCCACCTGCCGCACAACAAGCATTACAAATGAGTGGCTCTCTGGCATTTGGTGCTGTGGCAGATTTGCAAACACGACTTTCCCAACAGACCGAAGCCTCAGCTTTAGCTGCAGCTGCGTCTGTTCAACCTCTTGCAACACAGTGTTTCCAACTTTCTAACATGTTTAATCCTCAAACAGAAGAAGAAGTTGGATGGGATACAGAGATTAAAGATGATGTCATTGAAGAATGTAATAAACATGGAGGAGTCATTCATATTTATGTTGATAAAAATTCAGCTCAGGGCAATGTGTATGTGAAGTGCCCATCTATTGCTGCGGCTATTGCTGCTGTCAATGCATTGCATGGCAGATGGTTTGCTGGTAAAATGATAACAGCAGCGTATGTACCTCTTCCAACTTACCACAACCTCTTTCCTGATTCTATGACAGCAACACAACTACTGGTTCCAAGTAGACGATGAAGGAAGATACAGTCCCTTATGTATATAGCTTTTTTTTCTCTTGAGAATTCATCTTGAGTTATCTTTTATTTAGATAAAATAAAGAGGCAAGGGTCTACTGTCATTTGTATACAACTCCTGTTACCTTGAAAAATAAAAATGTTAACAGGAATGCAGTGTGCTCATTATCCCTAACTAGCAAATCCTACTTTATGCAAAGCTGTTCTCTTGTTCTGCTGTTTTAAATGTCCATGTAGAAAATGACATTAAGGATCTATAGAATAGCTCTAGGGGAACAAATGTGCTTTCTGTATAAAGGCAGACAGGTCACGTTTTAATGTTTCAGAAACCTAACTTTTTACACAGCAGTTACAATTCACATTCATGTATTTGGCTCATGGTTCAGCAAAGGTTTCCAGAATCCACATTTAGTGTGTGAAAAGTCTAAGTGGCTGTATGGCTGCTTGGCATTTGATCTTGATTATTTGGCAAGAATGGGATTTCAAAATAATATTTCTCGATGGTAATTTTTTCAATTAATGTCTCTGTAAAAGTTTCTTTGTAAATACTGTATGTTTTAGTGTGTCTTGAGATTCCAAACAAAATGATCCCTGCATTTCCTCAAGGTGGCTGACGTAACAGATTGAGTAAGCAGTCTTGGGCAAGAGATGGGAAATGCAGAAAAAGGTTTTGTCTGGTTGCATATAATCTTTGCTCTTTTTAAGCTCTGTGAGCTCTGAAATATATTTTTGGGTTACTTCAGTGTGTTTGACAAGACAGCTTGATATTTCTATCAAACAAATGACTTTCATATTGCAACAATCTTTGTAAGAACCACTCAAATAAAATTCTCTGAAAAAGGCCACAAGAAAA