Transcript asmbl_25288

Sequence
Transcript Sequence for observation asmbl_25288 of TGE0000820:
CGGCAGAGGCGGGCAGAGGCGGCGAGAGGCGGCGAGAGGCGGGCTGAGGCGGCCCAGCGGCGGCAGGTGAGGCGGAACCAACCCTCCTGGCCATGGGAGGGGCCGTGGTGGACGAGGGCCCCACAGGCGTCAAGGCCCCTGACGGCGGCTGGGGCTGGGCCGTGCTCTTCGGCTGTTTCGTCATCACTGGCTTCTCCTACGCCTTCCCCAAGGCCGTCAGTGTCTTCTTCAAGGAGCTCATACAGGAGTTTGGGATCGGCTACAGCGACACAGCCTGGATCTCCTCCATCCTGCTGGCCATGCTCTACGGGACAGGTCCGCTCTGCAGTGTGTGCGTGAACCGCTTTGGCTGCCGGCCCGTCATGCTTGTGGGGGGTCTCTTTGCGTCGCTGGGCATGGTGGCTGCGTCCTTTTGCCGGAGCATCATCCAGGTCTACCTCACCACTGGGGTCATCACGGGGTTGGGTTTGGCACTCAACTTCCAGCCCTCGCTCATCATGCTGAACCGCTACTTCAGCAAGCGGCGCCCCATGGCCAACGGGCTGGCGGCAGCAGGTAGCCCTGTCTTCCTGTGTGCCCTGAGCCCGCTGGGGCAGCTGCTGCAGGACCGCTACGGCTGGCGGGGCGGCTTCCTCATCCTGGGCGGCCTGCTGCTCAACTGCTGCGTGTGTGCCGCACTCATGAGGCCCCTGGTGGTCACGGCCCAGCCGGGCTCGGGGCCGCCGCGACCCTCCCGGCGCCTGCTAGACCTGAGCGTCTTCCGGGACCGCGGCTTTGTGCTTTACGCCGTGGCCGCCTCGGTCATGGTGCTGGGGCTCTTCGTCCCGCCCGTGTTCGTGGTGAGCTACGCCAAGGACCTGGGCGTGCCCGACACCAAGGCCGCCTTCCTGCTCACCATCCTGGGCTTCATTGACATCTTCGCGCGGCCGGCCGCGGGCTTCGTGGCGGGGCTTGGGAAGGTGCGGCCCTACTCCGTCTACCTCTTCAGCTTCTCCATGTTCTTCAACGGCCTCGCGGACCTGGCGGGTTCTACGGCGGGCGACTACGGCGGCCTCGTGGTCTTCTGCATCTTCTTTGGCATCTCCTACGGCATGGTGGGGGCCCTGCAGTTCGAGGTGCTCATGGCCATCGTGGGCACCCACAAGTTCTCCAGTGCCATTGGCCTGGTGCTGCTGATGGAGGCGGTGGCCGTGCTCGTCGGGCCCCCTTCGGGAGGCAAACTCCTGGATGCGACCCACGTCTACATGTACGTGTTCATCCTGGCGGGGGCCGAGGTGCTCACCTCCTCCCTGATTTTGCTGCTGGGCAACTTCTTCTGCATTAGGAAGAAGCCCAAAGAGCCACAGCCTGAGGTGGCGGCCGCGGAGGAGGAGAAGCTCCACAAGCCTCCTGCAGACTCGGGGGTGGACTTGCGGGAGGTGGAGCATTTCCTGAAGGCTGAGCCTGAGAAAAACGGGGAGGTGGTTCACACCCCGGAAACAAGTGTCTGAGTGGCTGGGCGGGGCCGGCAGGCACAGGGAGGAGGTACAGAAGCCGGCAACGCTTGCTATTTATTTTACAAACTGGACTGGCTCAGGCAGGGCCACGGCTGGGCTCCAGCTGCCGGCCCAGCGGATCGTCGCCCGATCAGTGTTTTGAGGGGGAAGGTGGCGGGGTGGGAACCGTGTCATTCCAGAGTGGATCTGCGGTGAAGCCAAGCCGCAAGGTTACAAGGCATCCTCACCAGGGGCCCCGCCTGCTGCTCCCAGGTGGCCTGCGGCCACTGCTATGCTCAAGGACCTGGAAACCCATGCTTCGAGACAACGTGACTTTAATGGGAGGGTGGGTGGGCCGCAGACAGGCTGGCAGGGCAGGTGCTGCGTGGGGCCCTCTCCAGCCCGTCCTACCCTGGGCTCACATGGGGCCTGTGCCCACCCCTCTTGAGTGTCTTGGGGACAGCTCTTTCCACCCCTGGAAGATGGAAATAAACCTGCGTGTGGGTGGAGTGTTAGGACCAACGGTTTCCTAGGA