Transcript asmbl_11115

Sequence
Transcript Sequence for observation asmbl_11115 of TGE0003561:
GGCGCCGCCGCCGCCGCTGTTTCGTAGCCGGGGCTGCGGCCGCAAGAAGAAGGATCTCCCTCTCGCTCCCCGCCGGCGCCTGGCCCGCCCGCTACGCCCCGACGCGTCTCCCATGCCTGCCCCCGGCCCGGCTGCCGACGGACGTCGCGTCAGCGCCCGGATTTAACACGGAAGCCCGGGTCGGGGGCCGCGGGGGGAGGACGAGGGAGACCCGGTAGGTCCCGCGCCCTTCTCGGCCCGGCGCGGCGCCTCGGCGGGAGCCATGACCTCGCTGACCCAGCGCAGCTCGGGCCTGGTGCAGCGGCGCACCGAGGCCTCCCGCAACGCCGCCGACAAGGAGCGGGCGGCGGGCGGCGGCGGCGGAGGCAGCGGCGAGGACGACGCGCAGAGCCGCCGCGATGAACAGGACGACGACGACAAGGGCGACTCCAAGGAAACGCGGCTGACCCTGATGGAGGAGGTGCTCCTGCTGGGCCTCAAGGACCGAGAGGGTTACACATCTTTTTGGAATGATTGTATATCATCTGGATTACGTGGCTGTATGTTAATTGAATTAGCATTACGAGGAAGATTACAACTAGAGGCTTGTGGAATGAGACGTAAAAGTTTGTTAACAAGAAAGGTGATCTGTAAGTCTGATGCCCCAACAGGGGACGTTCTTCTTGATGAAGCTCTGAAGCATGTTAAGGAGACTCAGCCTCCAGAAACAGTCCAGAACTGGATAGAGTTACTTAGTGGTGAGACGTGGAATCCATTAAAACTGCATTATCAGTTAAGAAATGTGCGGGAACGATTAGCTAAAAACCTGGTAGAAAAGGGTGTACTAACAACAGAGAAACAGAACTTTCTACTTTTTGACATGACGACACATCCCCTCACCAACAACAACATTAAGCAGCGCCTCATCAAGAAGGTTCAGGAAGCTGTTCTTGACAAATGGGTGAATGACCCTCACCGCATGGACAAGCGCTTGCTGGCCCTCATTTACCTAGCCCATGCCTCCGATGTTCTGGAGAATGCTTTTGCTCCGCTTCTGGATGAGCAGTATGATTTAGCTACGAAGAGAGTGCGGCAGCTCCTTGACTTAGATCCTGAAGTGGAATGTCTGAAGGCCAACACCAACGAGGTTCTGTGGGCGGTGGTGGCAGCATTCACCAAGTAACTCTGCTCAGAATGAAGTATTCTCCTTCCTCTCATGTAAACCAGTAGTTTTTCTTCTATTGACTTCTGGTTTTCTGCAGTTTGTATTTTCCCACACTATAATTGGCTTTTATTTTATGAAATAGTAAGTGGCTTTTTAAAAATATATATATATGTATGCAGGATTCTGCTGGTACGAGAGGCCTTCCTCTTTCTGTTTTAAAAAAAGTTTTACTGCCATATTGGCATTCCATTCCTTGTTGCCATTCTCACCATTACCTGTTTGGGGTTTCTGGTATGCTTTGACTTTCAAAGTACCTCCAGTCTCCTTACATGCACATCTTTTGGATTACCTCAGGTTGAGTTGTTCCCACATGTGCATGCACATCTCATATTCTGCCTACAGTTCAGACGGAAGTCACAAAAAGGCCTTTAACTCACCAAAGGTAAATATCTTTATCTATTAGGACATTTTATACATAGACCTCAGTTGAGATGTATACTTAGCAAAATTATTTTTAAATTGAAACAACACAGTAAATAATATAAAATGCCCCTTGGATTTTGCTTCCCATACGAATCTATTATAAGACTTGTTATAATTTTAACTATTAAATCACAAAGGTCCAGTCGTTTCACAAAGCCAGTTTGGGATAGGCTGCATTCCAGTTATGCTGTATATAGTTTGAATTATATATAAATTGCCCCTTCTGGCCACCCCACCTCCATCTTAGTATTTTGCAAGATTTAATTAGTTGCACACCTGGTGCCCCTCACTTGCTTTAGTCATTATTTGATGGCAAAATAGACCCCTCATCATTGAAGGAGAGAGAGGTGTGTCTGGTCCTGATATTTTTTTAGCTGTGCCATTCATGGCACTCTTTGCCTATGCATCTCCTTTTTGGAATGATTTTTGAGTCTTACTGTTTTTATCATTTCTGTAGGGAAGAGGCTTGTGACCAGTACTAATCTTGAGTACAGTTTTTTCTTTTTTTGACCATAAGTAAATTAATGTCTGCTCTTAAATGTCATTTATCGACTCACACTTTCTTGGGGAAAAAAATTAAATGTCAGTCCTAGCAGATTTTGCATGTAAATTGTTAGCAAGTGATGACTACAATTCAGATGATTAAGAATTTTGTAACAGAAGCTCTGCTATGTTTTAATTTTTATATACAATTATGATAATTAGCACATTGTAAGAATATAAACCTTTGCTTTTTAAAGTTTATTTTTACTATTTCTTTATCACTGTTTATCATATCACCATTGGTTTCATAATGTAAATACTATATATTGAAAAAACGTCAAATTTTGTATTACTGTAGTTCATGTTAATAGTGGGGCTTTCAGGTGTTTAGAGATTTTTTTGGTTAACAGTCAATGCAAAAGTACTAGATGGTGTATAACTCTAGAGTTGAATTTTAAGGGATTCTCTAATCTGTATACTACCTTTTTAACTGAAGTAATAAAATAAACTATGATCTTGAAAGTGCCTGAATCAGA