Transcript asmbl_27555

Sequence
Transcript Sequence for observation asmbl_27555 of TGE0032891:
CAACTTAAACCGAATTCCTGGAGGAGTCTTCCGGCTTGGGCCTCCGCTGTGGTGCGGTTGTTGGGCACAATGCTTCCGGCCTCTTGTGCCTCACTTGTGGACTGGAGACTCAGGCCTCACTCACTTCGGTTCCTCAATTAACAGCAGAACCATCAACAAATGTTTGTTGGATAAGGACAAATAAAGAGATTGGAAAGGAGCGAAGCCTTTTTGACTTGTTTCACTTGTTCCCGCCTACTCCATCTTCTTCCAGGTCAGGGGGTGTGCCTCAGAGAAAGAAGGAAACGAATTTTGCGGGCGGTCACACACTTGGAACGTTTAGTCGGGCCTTTGGATTTCCCTAGTGTCTGTAATCACGCCGGGATCTCTTCTAATGGAACTCATTTGGTCAATGGCCTCACTATCCTCACATCATTCCTTTTTTTAGTTTGCGGTACTTCTGGAAACTGAAAACTAGCACAGGAGAATAGATGGGACTAGTAAAAACAGCAAAACCCACATCCCTGCGAGCTTCTTGCTTACGAAATCGATGCTCTAATCATTTATTTTGATCCCATTCTACTGCTTCAGTTTCTCTTTCATTTAACAGTTCCAACAGTCATGGAGAAGCGCCTTCAGGAGGCTCAGGTATACAAGGAGGAAGGAAACCAGCGCTACCGGGAAGGAAAGTACCGAGATGCTGTGAGTAGGTACCATCGAGCTCTTCTTCAGCTGCGGGGTCTGGACCCAAGTCTGCCTTCCCCTCTTTCTAGTCTGGGACCTCAGGGCCCAGCTCTCACACCGGAGCAAGAAAACATACTGCACACCATCCAGACCCACTGCTACAACAACCTAGCTGCCTGTCTCCTCCAGATGGAGCCAGTGAACTATGAACGAGTGAGGGAATACAGTCAGAAAGTCCTAGAACGACAACCCGATAATGCCAAGGCCTTGTATCGGGCTGGAGTAGCCTTCTTCCACCTGCAAGACTATGACCGGGCTCGACACCACCTGCTTGCTGCTGTCAATAGGCAACCTAAAGATGCCAATGTTCGGCGGTACCTCCAGTTGACGCAGTCAGAACTCAGCAGCTACCATAGGAAGGAGAAACAGCTGTACCTGGGCATGTTTGGTTAATGAAGAAAAGAGACATTTCTCAACTTGAACTCAAGTGGACAAGCAAAGGCCCATTGGGGAATCTGAGCCTCACTCAGCAAAAGGAGTTCACCCTTTACCTCTGACCCAGGCAGACTTGGTGGTAGATGCCTGCAATCCCAGCACTTTGGAGTCTAAACCATGACAATCACAAATTCAAGGTCAGTCAGATCTTGTCTCAGAATTAAAGGGCTGGAGATAACAGCTCTGTGGGAAAACCCTGGGTTTAATTCCCCTTTCTGGTTTTTGGTTTGCTTTGTTCCCTCCTGGTAATTTCTAGTCCTTGCTATTGCTTGCACTCAGATCACTGACAAAGTACAACTTATTTGTCATTAATTTAGTCTTTTTTTAAAACTTCTGGAGTGAATGCCTGGGATACATGAAACCCTGTTTTTACCTTCTCTCTGACCTTGTGCCAAGAAGGAACCCAAGTGCTGGTGCACTTTCTCTGGGTGTGTGTGTATGTATGGTGTGGGAGCTT