Transcript asmbl_25285

Sequence
Transcript Sequence for observation asmbl_25285 of TGE0000818:
CGGCACGCCGCGGCGGGGTGGGTGCAAGATGCCGCTGCCGGTTCAGGTGTTTAACTTGCAGGGGGCCGTGGAGCCCATGCAGATCGACGTGGACCCCCAGGAAGACCCGCAGAATGCACCTGACGTCAACTACGTGGTGGAGAACCCCAGCCTGGATCTGGAACAGTACGCGGCCAGCTACAGCGGCCTGATGCGCATCGAACGGCTGCAGTTCATTGCTGATCACTGCCCCACGCTGCGGGTGGAGGCCCTGAAGATGGCCCTCTCCTTCGTGCAGAGAACCTTTAACGTGGACATGTACGAGGAGATCCACCGCAAGCTCTCAGAGGCCACCAGGTCCTCTCTCAGGGAGCTGCAGAACGCACCCGACGCCATCCCTGAGAGCGGCGTGGAGCCCCCAGCCCTGGACACGGCCTGGGTGGAGGCCACGCGGAAGAAGGCGCTGCTGAAGCTGGAGAAGCTGGACACAGACCTGAAGAACTACAAGGGCAACTCCATCAAAGAGAGCATCCGGCGCGGCCACGACGACCTGGGCGACCACTACCTGGACTGTGGGGACCTCAGCAACGCCCTCAAGTGCTATTCCCGGGCCCGGGACTACTGCACCAGCGCCAAACACGTCATCAACATGTGCCTCAATGTCATCAAGGTCAGCGTCTACTTGCAGAATTGGTCTCATGTGCTCAGCTACGTCAGCAAGGCTGAGTCCACCCCAGAGATTGCCGAGCAGCGAGGAGAGCGTGACAGCCAGACCCAGGCCATCCTCACCAAGCTCAAGTGTGCCGCAGGCTTGGCAGAGCTGGCCGCCAGGAAGTACAAGCAGGCTGCCAAGTGCCTCCTGCTGGCTTCCTTTGATCACTGTGACTTCCCTGAGCTGCTGTCCCCCAGCAACGTGGCCATCTACGGTGGCCTGTGCGCCTTGGCTACCTTTGACCGGCAGGAGCTGCAGCGCAATGTCATCTCCAGCAGCTCCTTCAAGTTGTTCTTGGAGCTGGAGCCACAGGTCCGAGACATCATCTTCAAATTCTACGAGTCCAAGTACGCCTCATGTCTCAAGATGCTGGACGAGATGAAGGACAACCTGCTCCTGGACATGTATCTGGCCCCCCATGTCAGGACCCTGTACACCCAGATTCGCAACCGTGCCCTCATCCAGTATTTCAGCCCCTACGTGTCAGCCGACATGCATAGGATGGCGGCAGCCTTCAATACCACGGTGGCCGCCCTGGAGGACGAGCTGACGCAGCTAATCCTGGAGGGGCTGATCAGTGCCCGTGTGGACTCACACAGCAAGATCCTATACGCCCGGGACGTGGATCAGCGCAGCACCACCTTTGAGAAGTCTCTGTTGATGGGCAAGGAGTTCCAGCGCCGCGCCAAGGCCATGATGCTGCGGGCAGCTGTGCTCCGCAACCAGATCCATGTCAAGTCCCCGCCCAGAGAAGGGAGCCAGGGGGAGCTGACTCCAGCCAACAGCCAGTCCCGGATGAGCACCAACATGTGAGGGGTGAACCTTGGCCTCCAGGACATCTGCACCCCCTCCCCACCTCCACGGACCTCGGACCTCCAGGCGGCTCAGTGCTGCCTGCGGCCCAGCTAAGGGGCCTGGCCACTGGGTGCCACCCAGCCTGTGTGCCCTCCCTGGGGCTGAGGAGGCAGGCGGCTGCTAGTTGTGGCCCTTCCTGGAAGGAGAGGCCTGCAGGGCTCGACCCTGTGGGTTTCTGTCCCCAGGGAGCAGACTGTGCGGCACCCAGGCCCAGTGGCACCATTTCCCAGACCCCTCCTGTTCCCGCCTCAGTCAGGTGCAGACAAGTGGGCGGTGTCCATTAAAGAGCAGACTCAGCGTT