Transcript asmbl_10739

Sequence
Transcript Sequence for observation asmbl_10739 of TGE0003546:
AAGTGGACGCGCTGAAAGGATCTGTGAGTATCACGCCACCATAAAAGAGGGAAAGTTACCCTATTGGATCTGTTCAGTTGACCAAGCTCATGGCGACATCTGAGCAAAACTTCAGATGAATATTTTCATCCAAAGAAAATAAATTGTCAAGACACGTTCAAAAGCACTTGAGATCTGAAGGTTGTTAGCTTGTGTATATTATGCTTCCAATAAGAAAAAAATACTTGTGTTCTCCGCCTAAAATCGGAGTGTTTGCCATTTGCCACTAAGGAAAATGGTTGCAAACGTTCAGTAAACTGTTCTGGGAATAGCTGGGCTTTTCTGACACTTGACCTGAGAAGTCTTTCTCATCTCCTGTAGAATGAGTCTCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCTATGGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAACATGAAGGAAGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTGAATGTTAAGATGGCTCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGATTGCTCTGCCTCTTCCAACCTTTTCTTCCCTGAACCTGAGGGAAACCAATCTGGATTCGCTCCCTCTGGTTGACACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAATGAAACTTCTCAGCATCACGATGACCTGGAGTGAAAATTGCACAGAGTTGGTGCAGCAATATTATTACCAGCAACAATAAAAAAGAAATTCATTTCTTAAAGAAACAGCTTTTAAGTGCCTTTCTGCAGTTTTTCAGGAGCGCAAGATAGATTTGAAATAGAAATAAGCTCTAGTTCTTAAGAACCAACACTCCTAAAAGATTTAGAAAAAAGTTTACAACGTAATCTAGTTTATGAAGAAGTCTTGTGCTAGAATACTTTTTAAAAAGTATTTTTGAATACCATTCAAACTGCTTTTTTCCAACAAGTATCTGACCAATGTGTCTCTGCTTCAATAAATCTTTGAAATCTGTTTCGGTGTCTTATTTGATAATATAT