Transcript asmbl_10734

Sequence
Transcript Sequence for observation asmbl_10734 of TGE0003541:
GCCGAGAGCACCCTGCAGTCCTTCAGACAGGATGTTGATGGTGCTTCTTTGGCACGTCTTAACCTTGAGCGTAAAGTGGAATCCTTGCAGGAAGAGATTGCCTTTTTGAAGAAACTCCATGACGAGGAAATCCAGGAGCTGCAGGCCCAGATTCAGGAACAGCATGTCCAGATCGATGTGGATGTTTCTAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAGTATGAAAATGTGGCTGCCAAGAACCTTCAGGAGGCTGAGGAATGGTACAAGTCCAAGGTATGAACCAAGCCAGTGTGGCTGGAACAACAGGAAAGCATTTTGTTCTACAAATGCTGTACCCGTCTCTGATTCTTAAATACCCTTTAAATCCAGTGAGAAAGGTGGCTTTAAGTTCAAGTTTTGTTTGTTGTTACAGCCTCCCCACTACTCACATTCCCTAACCTCCCCCCAGAAGCAGACCCCCTTCCCATTACCCTATTTTGATTCTACTTCAGAGTAAACCCCAACACCATGACCTTGACCTCCGCCCTTTTTAAATGGGAGTAACAAAGTGAGTTTCTACTTGAAAATATCAGCGTCAGTATTCCACTGCTCTTTCTCCGGTTTTCAAAACAGAAATTCAGACACGTTTTGGCAGACATTGAGCTTTGAACTTAAAATATAAAATCTGGTTTGTATCGTGATTTGTTTGTTTGCAATTTTTAAGCTTTCTCATTTGTCCAGGTAAGGTAGCATCTTAGAATTGAGTCACTTAGATGGTCTACATTTCTGATTTCTTCCGACAGTTTGCTGACCTCTCCGAGGCTGCTAACCGGAATAATGATGCCCTGCGCCAGGCGAAACAGGAGTCAAATGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGACGCGCTGAAAGGATCTAATGAGTCTCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCTATGGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAACATGAAGGAAGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTGAATGTTAAGATGGCTCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGATTGCTCTGCCTCTTCCAACCTTTTCTTCCCTGAACCTGAGGGAAACCAATCTGGATTCGCTCCCTCTGGTTGACACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAATGAAACTTCTCAGCATCACGATGACCTGGAGTGAAAATTGCACAGAGTTGGTGCAGCAATATTATTACCAGCAACAATAAAAAAGAAATTCATTTCTTAAAGAAACAGCTTTTAAGTGCCTTTCTGCAGTTTTTCAGGAGCGCAAGATAGATTTGAAATAGAAATAAGCTCTAGTTCTTAAGAACCAACACTCCTAAAAGATTTAGAAAAAAGTTTACAACGTAATCTAGTTTATGAAGAAGTCTTGTGCTAGAATACTTTTTAAAAAGTATTTTTGAATACCATTCAAACTGCTTTTTTCCAACAAGTATCTGACCAATGTGTCTCTGCTTCAATAAATCTTTGAAATCTGTTTCGGTGTCTTATTTGATAATATAT