Transcript asmbl_10732

Sequence
Transcript Sequence for observation asmbl_10732 of TGE0003539:
GTCTCGGGGGAGGAGGCAGCGCGCAGGGAGCAGCGGGAAGGCGCTCGGGAGCCGGAGCGGGCGCGGCGGCGGTGGGCCCGAAAACACTAGAATCTTCTGGTGCCATCAGAAATGTCTCCCTTAAGTGGCAAAGTCCAGACTGTCTTGGGGCTGGTGGAGCCGAACAAACTGGGCCGCACCCTGACCCACGAACATCTGACAATGACCTTTAACTGCTCTTACCACCCACCGCCTCCATCTCATGAAGCTCTCTCTCGGGAGCCTATTATGATGAAAAATTTGTTTTGGATTCAGAAAAACCCTTACTCCCATAAAGAGAATCTTCAGCTGAATCAGGAGACGGAAGCCATCAAGGAAGAACTGTTGTATTTTAAAGCCAAAGGTGGAGGGGCCTTGGTGGAGAACACGACCACTGGGATCAGCCGCGACGTGCAGACTTTGAAGCGGCTGGCGGAAGAGACGGGCATTCACATCATATCTGGAGCTGGGTTTTACGTGGATGCAACTCACTCTTCTGAGACCAGAGCCATGTCGGTGGAGCAGCTGACTGACGTCCTCGTTAATGAAATTCTCCATGGAGCTGATGGGACCAGTATCAAGTGTGGCGTTATTGGAGAAATCGGTTGCTCCTGGCCTCTGACTGACAGTGAAAGGAAGGTTCTCCAGGCGACGGCTCATGCCCAGGCCCAGCTCGGCTGTCCTGTTATCATTCACCCTGGAAGGAATGCAGCCGCACCCGTTCAGATCATCCGAGTACTGCAAGAAGCAGGTGCAGACATCTCCAAAACAGTTATGTCGCACATCGATAGGACTATACATGATAAGAAGGAACTACTGGAGTTTGCTCAACTTGGCTGTTACTTGGAATATGATCTCTTTGGTACCGAACTCCTTCATTACCAATTCAACCCAGATATTGACATGCCTGATGATAATAAAAGAATTAGAAGGGTGCGTCTTCTGGTGGATGAGGGCTATGAAGATCGAATTCTGATGGCACACGACATACACACGAAGCACCGGCTGATGAAATACGGAGGTCACGGCTATTCTCACATACTCACCAACGTTGTCCCTAAAATGTTGCTCAGAGGTATAACTGAGAATGCGCTTGATAAGATACTGATAGAGAACCCTAAGCAATGGCTGACTTTCAAATAGGATGGTTAGGAATTCACACCTTGAGCATAAAGCTTACAGAGATCATCCGGTGGTTTCGAACCCAGTGAGTTATCAATCAGACCTACATAGGGCTAATGACAGATCATTTGCATTTTATGGGAATTAGAAGAGTTTTCCCTTCTCAGAAACTGGCTATTACATCTGAACCTGCAAGGGGCCTCACTCAGCCCACTGCCTTAACAAAATAAATACACAAAATACCTATTTCCAAACCATGATTTACAGTCTATATCCTCTTGGTAGAGTTTTGTTTTGTTTTGTTTTCTTAATCTATCAGCTGTACTACTTGTGAAAATTTAAAGTGTTTCTAGTTAAATTACCCCCTTCTGGAGCAATCTAATGTTTCTTGTAGTATTGATGATCCTACTAATTATCCTGCTGTTCTTTAATTAATGCTTAATGAATAATATGGCACTTTAAAATAAAACAGCTTCTGCAGCAAGGGAAGTTAAATTCTGAGATTTCTTTTCAACGAATACTGTTAAGACAAATACCAATTCAACAATGGTAAAACTATTGTGGAAAGATAATTATAT