Transcript asmbl_25498

Sequence
Transcript Sequence for observation asmbl_25498 of TGE0002143:
GTGAGATCAGAGGCCCCATGTGAGCGGATTGCAACACATGCAGCTGCCTGGAGAGAGGGAGCCGGTGTCCTACGTCAGAGCCGCCGCCGCCGCGGAGCCGCCGCCGGGGAGGAGCAGCCGCTGCCGCCCAGGACTGGGCCCTTAGGGAGGAGGAGGCGAGAAGATGGCGGACGACCCCAGTGCTGCCGATAGGAACGTGGAGATCTGGAAGATCAAGAAGCTCATTAAGAGCTTGGAGGCGGCCCGCGGCAATGGCACGAGCATGATATCGCTGATCATTCCTCCCAAAGACCAGATTTCACGAGTGGCAAAAATGTTAGCAGACGAGTTTGGAACTGCATCTAACATTAAGTCACGAGTAAACCGCCTTTCAGTCCTCGGAGCCATCACATCTGTACAACAGAGACTCAAACTTTATAACAAAGTACCTCCAAATGGTCTGGTTGTTTACTGTGGAACAATTGTAACAGAAGAAGGAAAGGAAAAGAAAGTTAACATTGACTTTGAACCTTTCAAACCAATTAATACATCATTGTATTTGTGCGACAATAAGTTTCATACAGAGGCTCTTACAGCGTTACTTTCAGATGACAGCAAGTTTGGTTTTATTGTAATAGACGGAAGTGGTGCTCTTTTTGGCACGCTCCAAGGAAACACCAGAGAAGTCCTGCACAAATTCACTGTGGATCTCCCAAAGAAACACGGCAGAGGAGGTCAATCAGCCTTGCGTTTTGCCCGTTTAAGAATGGAAAAGAGACATAACTATGTTCGGAAAGTAGCCGAGACTGCTGTGCAGCTGTTTATTTCTGGAGACAAAGTGAATGTGGCTGGTTTGGTTTTAGCTGGATCAGCTGACTTTAAAACTGAACTAAGTCAATCTGACATGTTTGACCAGAGGTTGCAATCTAAAGTTTTAAAATTAGTTGATATATCCTATGGTGGTGAAAATGGATTCAACCAAGCTATTGAATTATCTACTGAAGTTCTCTCCAACGTGAAGTTCATTCAAGAGAAGAAATTAATAGGACGATATTTTGATGAAATTAGCCAGGACACAGGCAAGTACTGTTTTGGAGTTGAAGATACACTAAAGGCTTTGGAAATGGGAGCTGTAGAAATTCTAATAGTCTATGAAAATCTGGATATAATGAGATACGTTCTTCATTGCCAAGGCACAGAAGAGGAGAAAATTCTCTATTTAACTCCAGAACAAGAGAAGGATAAATCTCACTTCACAGACAAAGAGACTGGACAGGAACACGAACTGATAGAAAGCATGCCTCTCTTGGAATGGTTTGCTAACAACTATAAAAAATTTGGAGCTACACTAGAAATTGTCACAGATAAGTCACAAGAAGGATCACAGTTTGTGAAAGGATTTGGTGGAATTGGAGGTATCTTGCGGTACCGAGTAGATTTCCAGGGAATGGAGTACCAAGGAGGAGATGATGAATTTTTTGACCTTGATGACTACTAGGTAGTCGACATGGGTCCGGCAACCGTGCCTCACCCTCCAGCATTCAACCCAAGGAGCATACCCGTGGTGGAGTCCAACAGATCCCTGCCTTACAATTGGAGCATTTCCAGAACTTAATCCGTGAGCATTGGATACTGAAAAGAAAAGTGAAACAAAACCAGACCCAACCCTACACTTTGGTTTGTCGTGGTGTCAGCGCAGCAGCCGACAACTAAGTCTCTAAAGGCCACTGTGGACTCATTTAAAAAGAATCCCAGTTTTTACTTTTACTTGATGGTAAAATTGGTTGCTCTTGTATTTTATGAAAAAATGATTTTTTTAACCTTCATACATAGAAGCAAAATACTTTAACTGCTGTAAACCTTCAAAAGTTAGTAGACGTGAGGTCATACTGGTTTGTTTCTTCCTTTGATCGGAGAATAACTAAATTGCTGCATTTCGCAGTGACCCATTTACATGGCATTCTCGGCTTAGACTGCACAAGAAGAAATATATGTGAAATATTGGAACTGTTTCTCTCTTGGTCTCTGTTTAATGTTGAAAGGGTGAGCTGACAGGAGGCAGTTTGAGCTTCACTCCCTCACACTCCCCACTCCCAGACTGTCCCTTTCAAAGGTGCAGGTTGCGTTGTAAAGTCAGACTGAGTGCCAACACACTGGGGCCAGGGCACTCTGGGCAGTCACCAGTGTGGAGGCACAGTTGTGCCTGGCATTTGGGAGCCCTCTGTGCCATTAGCGTTACTGAGGCTCCCTGTCATCTCAGCCTACTAGAAACCAGTCTGGGATGGACATGATGGGCTTCTGTGCTATTGCTGGGATTGGGAGAAATAAAACATGCAACTTAAGTGGAACCAAAAAAAAATTCAAAGATGATTTTGCTTGGATCTATTCTTGGTAAGGGGAGGCGGTGGTGTTTCCTTGTGTTGGATGGCATGAGATTATGTGAATGTTTTGATTTTATTTTTTTGTTTTCAAATGAACTGCAAGATTTTTTTCACGGGAACGACAGACACGACACGTATGACCGTGCATGTATCTCAAACCCCTGGTGGGGCTGGAGCATCTATTTCAAAAAGTGGGATCTACAAGCACCTCTCAGATGAGAAAGTATGGAGGCG