Transcript asmbl_10700

Sequence
Transcript Sequence for observation asmbl_10700 of TGE0007980:
CGGTGAGGCCCGACTGGGCGACCTTCAGCGGGGCCGGTAGCACCATGTTTTCTCGGGCGGGCGTCGTTGGGGTCTCGGCCTGGGCCGTGCAGCCGCAATGGATCCAAGTTCGAAATATGGCAACTTTGAAAGATATTACCAGGCGACTAAAGTCAATCAAAAACATCCAGAAAATTACCAAGTCTATGAAAATGGTGGCAGCAGCCAAATATGCCCGAGCTGAGAGGGAGCTGAAACCGGCTCGCGTGTATGGAATAGGATCTTTGGCTCTTTATGAAAAAGCTGACATTAAGGGGCCCGAAGACAAGAAGAAACACCTCCTGATCGGAGTGTCCTCGGACAGAGGCCTTTGTGGTGCCATCCACTCCTCTGTCGCTAAGCAGATGAAAAACGAGGTGGCTACACTCACGGCGGCCGGGAAGGAAGTTAAGATTGTTGGAGTTGGCGATAAAATTAGGGGTATACTTCATAGGACTCACTCTGACCAGTTTCTGGTGACATTCAAAGAAGTGGGAAGAAAACCTCCCACTTTTGGAGACGCGTCGGTCATCGCCCTGGAATTACTAAACTCTGGCTATGAGTTTGATGAGGGGTCTATCATCTTTAATCAGTTCAGGTCTGTCATCTCCTACAAAACAGAAGAAAAGCCCATCTTTTCCCTCAATACCATTGCGAGTGCTGAGAGCATGAGCATCTACGACGACATTGATGCCGACGTGCTGCAGAATTACCAGGAGTACAGTCTGGCCAACATCATCTACTACTCTCTCAAGGAGTCCACTACGAGCGAGCAGAGCGCCAGGATGACGGCCATGGACAACGCCAGCAAGAACGCTTCTGAGATGATTGACAAGTTGACTTTGACTTTCAATCGCACGCGTCAAGCTGTCATCACAAAGGAGTTGATCGAAATCATCTCTGGTGCTGCGGCTCTGTAAGTAACTGCAGATGGCCTGCGGAGAGTTGGTTCTCATCTCTGTGTCTGCTGGTTTAAGCTTGGGATGTTTGAAAGTTTTTGCGTGTGTTTTGTCTGTTAAAGAGGAAATGATCCATTAATCTTGTAACCTTGCTCTTAGAGCATAAAAATCTGGTGAGAATGGAATCTCTGTTTATTCTGATGGTTCCGAACTCCGTTTCTTCTTGTTAGCAATCAGTATGTTACCAGCTTTCACTTCACCAAAGTATTAGGGATAAGGATTTGGATAATTCAGTATCATTTATAAAGTTTGTCTTTGGAACTTAAAATATTCACAACCAGGACTGGTTTGGGGTTTTGGGTTGGACTGGAAATCTCTAAATCATGGA