Transcript asmbl_25279

Sequence
Transcript Sequence for observation asmbl_25279 of TGE0014538:
GCCCTCCCCTTGTCAGCCCACCCTACGGAGAGAGCGCCCGAGCTCCCTTTCCCAGAGTGCTCCGCGCCGTGAAGAAGCGGCTCCCGGGGACTGGGGGCATTTTGTGTTGGCTGGAGCTAGAGTAACAAGATGGCGGCCTCGGCGGAGTGACGGCTTCCCTCCGGGCCGGAGCCGGCGGCAGTGGTGGCAGCGGTACCGCCCGCCCTCGTTCACCGCGCCCCTTTCCCAGCCCGCGACGTCGCCGCGACCACGAAAAAAAATCAGCGGCGGCCGCCCGAGAACAACAAGCGGCCGAGCTTCAGCAGCCGCGACCACCCTTCACGAACCGCGGCCTGGCCCTTCAGCGAGCGGCGGCGGCGGCGATCCGGCTTCTCTCTGCCGCCTGTGCGCCCCGTGACGCCGACAGAGCCTTGGGTTTAGGTTGCCCGCCGCGCTTCTCACTTCTGCCGCGGGTGGAACAGCCCCGGAGGCTTCCATCCTCTTCCTGAGGTGTCGGGGCTCGGCCCCCCGCCTCCATCTTCGCGTCTCAGGATGGCGAGCAGCAGCGGCTCCAAGGCCGAATTTATCGTCGGTGGAAAATACAAACTGGTGCGGAAGATCGGATCTGGCTCTTTCGGGGACATTTATCTAGCGATCAACATCACCAATGGCGAGGAAGTGGCAGTGAAACTAGAATCCCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTGTATAAGATTCTTCAAGGTGGGGTTGGCATCCCTCACATACGGTGGTATGGGCAAGAAAAAGACTATAATGTACTAGTCATGGATCTCCTGGGACCCAGCCTTGAAGACCTCTTCAACTTCTGTTCAAGGAGGTTCACTATGAAGACCGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAACCTCACTGGCACTGCCCGATACGCCAGCATCAATGCACATCTTGGTATTGAGCAGAGTCGCCGAGATGACATGGAATCTTTAGGATATGTTTTGATGTATTTTAATAGAACCAGTCTGCCGTGGCAAGGACTGAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACTCCTGTTGAGGTGTTGTGTAAGGGGTTTCCTGCAGAATTTGCCATGTACTTAAATTACTGTCGTGGGCTGCGCTTTGAGGAAGCTCCGGATTACATGTATCTGAGGCAGCTATTCCGCATCCTTTTCAGGACCCTGAACCACCAATATGACTACACATTTGATTGGACGATGTTAAAGCAGAAAGCAGCCCAGCAGGCAGCCTCTTCCAGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGTAACATGAAAGGTTAGTAGCCAAGAACCAAGTGACGTTACAGGGAAATTAAATGCAAATTGGATAATTCATTCAGTTCTAACAGTGTTAGATCAAGGAGGTGGTTTTAAAACATAAAATTTGGCTTCATATTTAAAAAA