Transcript asmbl_25277

Sequence
Transcript Sequence for observation asmbl_25277 of TGE0002158:
GCCCTCCCCTTGTCAGCCCACCCTACGGAGAGAGCGCCCGAGCTCCCTTTCCCAGAGTGCTCCGCGCCGTGAAGAAGCGGCTCCCGGGGACTGGGGGCATTTTGTGTTGGCTGGAGCTAGAGTAACAAGATGGCGGCCTCGGCGGAGTGACGGCTTCCCTCCGGGCCGGAGCCGGCGGCAGTGGTGGCAGCGGTACCGCCCGCCCTCGTTCACCGCGCCCCTTTCCCAGCCCGCGACGTCGCCGCGACCACGAAAAAAAATCAGCGGCGGCCGCCCGAGAACAACAAGCGGCCGAGCTTCAGCAGCCGCGACCACCCTTCACGAACCGCGGCCTGGCCCTTCAGCGAGCGGCGGCGGCGGCGATCCGGCTTCTCTCTGCCGCCTGTGCGCCCCGTGACGCCGACAGAGCCTTGGGTTTAGGTTGCCCGCCGCGCTTCTCACTTCTGCCGCGGGTGGAACAGCCCCGGAGGCTTCCATCCTCTTCCTGAGGTGTCGGGGCTCGGCCCCCCGCCTCCATCTTCGCGTCTCAGGATGGCGAGCAGCAGCGGCTCCAAGGCCGAATTTATCGTCGGTGGAAAATACAAACTGGTGCGGAAGATCGGATCTGGCTCTTTCGGGGACATTTATCTAGCGATCAACATCACCAATGGCGAGGAAGTGGCAGTGAAACTAGAATCCCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTGTATAAGATTCTTCAAGGTGGGGTTGGCATCCCTCACATACGGTGGTATGGGCAAGAAAAAGACTATAATGTACTAGTCATGGATCTCCTGGGACCCAGCCTTGAAGACCTCTTCAACTTCTGTTCAAGGAGGTTCACTATGAAGACCGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAACCTCACTGGCACTGCCCGATACGCCAGCATCAATGCACATCTTGGTATTGAGCAGAGTCGCCGAGATGACATGGAATCTTTAGGATATGTTTTGATGTATTTTAATAGAACCAGTCTGCCGTGGCAAGGACTGAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACTCCTGTTGAGGTGTTGTGTAAGGGGTTTCCTGCAGAATTTGCCATGTACTTAAATTACTGTCGTGGGCTGCGCTTTGAGGAAGCTCCGGATTACATGTATCTGAGGCAGCTATTCCGCATCCTTTTCAGGACCCTGAACCACCAATATGACTACACATTTGATTGGACGATGTTAAAGCAGAAAGCAGCCCAGCAGGCAGCCTCTTCCAGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGTAACATGAAAGGTTTCTAAGCATGAATTGTGGAAGAGAAGCAGCAGAGCAGACGATTGGAGCAGCGTTTGTTTCTCCCCAAACCTAGACATTTTAGTTCATATGTACACTAGCCAGTGGTTGTGGACAACCATTTACTTGGTGTAAAGAACTTCATTTCGGTATAAACTGGCTCTGGGTAGCACTGCGGATCCTGAGCTGTAGCCACTGTCCTTGTGAATATTAACTGAGGTAGTGAAACATGGTGTCCGGTTTTCTATTGCATTTTTTTTCAAGTGGAAAAGTTAACTAAATGGTTGACACACAAATTGGTGGAGAAATTGTGCATATGCCAATTTTTATTTTATTTTTTTGTTAAAATCTTTTATTTTGAACTATACTGCTTTGAGATCTCATTTCAGAAGAACGGCATGAACAGTCTTCAGCCACAGTTGTGATGGTTGTAAATGTTCACAATTGTGTGTTCTTAGGGTTTTCCATCCCTGGGGTTTGCAAGTTGTTAACTTAAAACATTCTTTAAATGGCTGGCTTCTTGTTTGCAAGCCAGCTGATATGGTAGCAACCAAAGATTCCAGTGTTTGAGCATTTGAAAGACTCTGCCTGCTTACCTGTGCTAGAAATAACAGCATCTAAAGTGAAGACTTAAGAAAAAAAACATAGCGACTACTAGATTCTCTTTAGGACTCTGCATTAACTCTATAATGTTCTTGCTATTAAAAAAAAGCATATTTGTCACGGAAATTTAGTTACCGTCTTACAACTGAACATGTATGTGTGTTGCTTAGATAAATGTAATCACTGTAAACATCTATACGATCTGGGATTTTGTTTTTATTTTGAAATGGGAGCTTTTTGTTTACAAGTTCATTAAAAACTAAAAACTGTTTCTGTAAGGAAGTGAAATTTTTTTAAACAACAAAATGCCTTGGCTGACTCACTATGAAGTGTGTGTGTGTGTGTGTGTACATATA