Transcript asmbl_10430

Sequence
Transcript Sequence for observation asmbl_10430 of TGE0003530:
GTCACGACAGCCGCCGCGACCGTCTCGCCGGCGCTCCGCGGGTAAGCGCTCCTGCCCGAGCCTCGCGGGATCAGCTTTTCCCTGGTTGCGGGCGTTTCCGTACTGTCGCCCCCTTCACCTTGGATCATGTTCAAGAAATTCGACGAGAAGGAAAACGTGTCCAACTGCATCCAGCTGAAAACGTCCGTTATTAAGGGCATTAAGAACCAGTTGACAGAGCAGTTTCCAGGCATCGAACCGTGGCTTAACCAAATCATGCCCAAGAAAGACCCCGTCAAAATAGTGCGGTGCCACGAGCACATAGAGATCCTCACGGTCAACGGGGAGCTGCTGTTTTTTAGACAAAGAGAAGGGCCTTTTTACCCGACGCTGAGGCTGCTCCACAAGTACCCGTTTATCCTGCCGCGCCAGCAGGTGGATAAAGGAGCCATCAAATTTGTCCTCAGTGGCGCGAACATCATGTGTCCAGGCCTGACGTCTCCCGGGGCCAAGCTGTACCCTGCCGCGGTGGATACGGTGGTGGCCATCATGGCGGAAGGAAAACAGCACGCCCTGTGTGTCGGAGTCATGAAGATGTCTGCGGAAGACATCGAGAAAGTCAACAAGGGGATCGGCATCGAAAATATCCATTATCTAAACGACGGACTGTGGCACATGAAGACGTATAAATGAGCCGCAGAAGGAGTGCGCCTGCGCCGATATGGACATTGTGCTGTGGCTGTGTTTGTGTCTGTGTGGCGGTATGAAGACGGTACCTCTGTGGTTACGTCGAATAAATTCAATGGATGCT