Transcript asmbl_10379

Sequence
Transcript Sequence for observation asmbl_10379 of TGE0003523:
GCCGAGAGTGGAGCTGCGCGTGGCTCCGAGTGCGCCTGCGCGGAGCGCCGGGACAGGGCGTGTTCCTCGTTCGGGTGCGCGTCTACCTCAGGCGGGCTGCGGTTTTCCCTCCCCGCAGTCGTGCGCCCTGCGGGACCCCGTCATTTCTACGCCCAGCCTGATACGTGCCGCTCTCCGCGATCATGTCCAAGTCTCTGAAAAAGTTGGTGGAGGAGAGCCGGGAGAAGAACCAGCCGGAAGTGGACATGAGTGACCGCGGCATCTCCAACATGCTGGATGTCAACGGCCTGTTCTCCTTATCCCACATCACGCAGCTGGTCCTCAGCCACAACAAGCTAACAACCGTGCCACCTAACATAGCGGAACTGAAGAATCTGGAAGTGCTCAACTTTTTTAACAACCAGATTGAGGAGCTGCCCACACAGATCAGCAGCCTTCAGAAACTCAAGCACCTGAACTTGGGCATGAACAGACTAAACACTTTGCCTCGAGGATTTGGCTCCCTCCCAGCCCTTGAGGTCCTTGATTTGACTTACAACAACTTGAATGAAAATTCTCTTCCTGGAAATTTCTTCTACCTGACCACCCTGCGTGCACTCTATCTAAGTGACAACGATTTTGAAATCCTGCCGCCAGATATTGGGAAGCTCACAAAGTTGCAGATACTCAGCCTTAGGGATAACGACCTGATCTCGCTGCCTAAGGAAATCGGGGAGCTTACTCAGCTTAAGGAGCTCCACATTCAGGGGAACCGCCTGACCGTTCTGCCCCCAGAACTAGGAAACTTGGATCTGACTGGTCAGAAGCAGGTATTCAAAGCAGAGAACAACCCCTGGGTCACCCCGATCGCTGACCAGTTCCAGCTTGGTGTGTCCCATGTATTTGAGTATATCCGTTCCGAGACGTACAAGTATCTCTACGGCAGACACATGCAGGCAAATCCAGAACCGCCGAAGAAAAATAATGACAAAACGAAAAAGATCAGCCGGAAGCCTCTGACAGCCAAGAACAAATGAGGGGTTGGCATGGGCTGGACTTCCGGTCACTTCGCTCGTTATTACTTCTGTTCTCTTGCTCTGTCCCACGATCAGTTATGGTTGACCCTTGAGCAACTTGGGTTTGAACTGAGCGGGTCCATTATATGCAGATTTTCTTCAATAAATTCTGCAAATGTATTTTCCTAATGATTCTCTTAAGATTTTCTTTTCTCTAACTTTGGTATAAGAATACAGTATATAATATGTATAACATACAAAATAGGTGTTAATAGACTGTTTACGTTAATAGACAGGAGGCTATCAGTAGTAAAGTTTTGGGGTGTCAGGTTATATGTGGATTTTCAACTGTGTAAGGGGGCGGCACCCCAACCCTCACATTGTTCAAGGGTCAACTGTACAGTGTGTATCTCTGAGTGTGTGTGAGTGCATGTGTTTCTTTTCATATTTTTCTTCCTACTGCTTACCAATTTTTATCTTTTAATTTCTTTTGGTAGGTAGTAGATTTTTATAAGTTTTAAAAACCCTTTCTTACCTTAAAAATTACCAAAGGCAGGAAACAAAGCTCTGATTCAACTGCTAATTCCGTAGTAGGCACTGATTTCAGCTCCTTGAATAGATGCTCGTAAAGTCGCTGCTTATCAAAAGCATAATTAAAATCACGTAATCGTTTAAATGTCACAGCACTGTTCACGCTTCTGTTTATTCATGTAATTCATTCTTTCGCCTTATTAAAAATTTTCCTTCGCCACTGAGATATTATGTTAACTTTCTTCACATACGATTTTAATAAAATCTTGAATTTGCACAACGTGTTGCCTCCTGAATACAGAACAATCTGACTTTGGGGTGTATACACATTTTTGTTTACTCTTTTTCCCAAAATTAATCTTGTCCACTTTTATTGGTTGTAGATGATAAACCCTGAAACTTCTCATGAAAAAAATGCAAAA