Transcript asmbl_228

Sequence
Transcript Sequence for observation asmbl_228 of TGE0032451:
CGGGAAGGTACTGTCCCATATAAGCCTCTGCTCTTGGGGCTCAACCGCTCGCACCCGCTGCGCTGCACAGGGGGAGAAAAGGAGCCCAGGGTGTGAGCCGGACAACTTCTGGTCCTCTCCTTCCATCTCCTTACCGGCGTCCCCACCTCAGGACTTTTCCCGCAGGCTGCGAGGGGACCCACAGTTCGTGGCCACTTGCCTCCTGGGGAGGGCGACTCTCCTCCCATCCACTCAAGATGCTCAGGGGTCCGGGACCCGGGCGGCTGCTGCTGCTGGCAGTCCTGTGCCTGGGGACCTCGGTGCGCTGCACCGAAGCCGGGAAGAGCAAGAGGCAGGCTCAGCAAATCGTGCAGCCTCAATCCCCGGTGGCTGTCAGTCAGAGCAAGCCTGGCTGTTTTGACAATGGGAAGCACTATCAGATAAATCAGCAGTGGGAACGGACCTACCTAGGCAACGCCCTGGTTTGTACCTGCTATGGAGGAAGCCGGGGTTTTAACTGCGAGAGCAAGCCTGAGCCTGAAGAGACTTGCTTTGACAAATACACTGGGAACACTTACAAAGTGGGTGACACTTATGAGCGCCCTAAAGATTCCATGATCTGGGACTGTACCTGCATCGGGGCTGGGAGAGGCAGGATCAGCTGTACCATTGCAAATCGCTGCCATGAAGGGGGTCAGTCCTACAAGATTGGCGACAAGTGGAGGAGGCCACATGAGACTGGTGGCTACATGTTAGAGTGTCTGTGTCTGGGAAATGGAAAAGGGGAATGGACCTGCAAACCTATAGCTGAGAAGTGTTTTGATCATGCTGCTGGGACGTCCTACGTCGTGGGGGAGACCTGGGAAAAGCCCTACCAAGGCTGGATGATGGTGGACTGTACTTGTCTAGGCGAAGGCAATGGACGCATCACCTGTACCTCCAGAAACAGATGCAACGATCAGGACACCCGGACATCCTATAGGATTGGAGACACGTGGAGCAAGAAGGACAACCGAGGAAACCTGCTTCAGTGTGTCTGCACAGGCAATGGCAGAGGGGAGTGGAAGTGTGAGCGACATGCTCTACAAAGTGCTTCAGCCGGATCTGGCTCCTTCACTGATGTCCGAACAGCTATTTACCAACCGCAGACTCACCCCCAGCCCGCTCCCTACGGCCACTGTGTCACCGACAGTGGTGTGGTCTACTCTGTGGGAATGCAGTGGCTGAAGTCGCAAGGAAACAAGCAAATGCTGTGCACGTGCCTGGGCAATGGCGTCAGCTGCCAGGAGACAGCCGTGACCCAGACTTATGGTGGCAATTCAAACGGGGAGCCCTGTGTCCTCCCGTTCACCTACAACGGTAGGACCTTCTATTCCTGCACCACCGAAGGGCGGCAAGACGGACATCTGTGGTGTAGCACAACTTCCAATTACGAACAAGACCAGAAGTATTCCTTCTGCACAGACCATGCGGTTTTGGTTCAGACTCGAGGCGGAAATTCCAATGGTGCTCTGTGCCACTTCCCCTTCCTGTACAACAACCGGAATTACACCGACTGTACTTCTGAGGGTCGCAGGGACAACATGAAATGGTGCGGCACCACCCAGAACTACGATGCCGATCAGAAGTTTGGATTCTGCCCAATGGCTGCCCACGAGGAGATCTGCACAACCAATGAAGGGGTCATGTATCGCATTGGGGATCAGTGGGATAAGCAGCATGACCTGGGCCACATGATGAGGTGCACGTGTGTGGGGAACGGTCGTGGAGAATGGGCCTGCATCCCCTACTCCCAGCTCCGAGACCAGTGCATCGTTGATGACATTACTTACAATGTGAACGACACGTTCCACAAGCGTCACGAGGAGGGACATATGCTGAACTGTACCTGCTTTGGTCAGGGCCGGGGCAGATGGAAGTGTGACCCCATTGACCAGTGCCAAGATTCAGAGACCCGGACATTTTACCAGATTGGTGACTCCTGGGAGAAGTTTGTGCATGGTGTCCGATACCAGTGTTACTGCTACGGCCGTGGCATCGGGGAGTGGCACTGTCAACCTCTGCAGACCTACCCAGGCACAACTGGACCTGTCCAAGTAATTATCACGGAGACCCCCAGCCAGCCCAATTCCCACCCCATCCAGTGGAATGCCCCGGAGCCTTCACACATCACCAAGTACATTCTCAGATGGAGACCTAAAACCTCTACGGGTCGCTGGAAGGAAGCTACCATTCCTGGCCACCTTAACTCCTATACCATCAAAGGCCTGACCCCAGGTGTGATCTATGAGGGACAGCTCATCAGCATCCAGCAGTATGGCCACAGAGAAGTGACACGCTTCGACTTCACCACCAGCGCCAGCACCCCTGTGACCAGCAACACGGTGACCGGAGAGACTGCGCCCTACTCTCCTGTTGTGGCCACTTCTGAATCTGTAACTGAAATCACAGCCAGCAGCTTTGTGGTCTCATGGGTCTCAGCCTCCGACACCGTGTCAGGCTTCCGGGTGGAGTATGAGCTGAGCGAGGAGGGAGATGAACCACAGTACCTTGATCTCCCAAGCACGGCCACTTCCGTGAACATTCCTGACCTGCTCCCGGGCAGAAAGTACATTGTCAATGTCTATCAGATATCTGAGGAGGGAAAACAGAGCTTGATCCTGTCTACCTCACAGACTACAGCACCTGACGCTCCTCCAGACCCTACCGTGGACCAGGTTGATGATACTTCCATTGTTGTTCGGTGGAGTAGACCCCAGGCACCTATCACAGGGTATAGAATTGTCTATTCACCTTCAGTAGAAGGCAGTAGCACAGAGCTCAACCTCCCTGAAACGGCCAACTCCGTCACCCTCAGCGACCTGCAGCCCGGTGTTCAGTACAACATCACTATCTATGCTGTGGAGGAGAACCAGGAGAGCACACCCGTTTTCATCCAACAAGAGACCACTGGCACCCCAAGATCTGATAACGTCCCCCCTCCGACGGACCTACAGTTTGTGGAACTGACTGATGTGAAAGTCACCATCATGTGGACCCCTCCTGATAGTGTGGTGTCTGGATACCGTGTGGAGGTCCTGCCTGTCAGCCTGCCCGGGGAACATGGGCAGAGGCTGCCTGTCAACAGAAATACCTTTGCTGAAATCACTGGGCTGTCCCCTGGGGTCACGTACCTCTTCAAAGTCTTTGCTGTGCACCAGGGCAGGGAAAGCAATCCTCTGACGGCACAACAGACCACCAAACTCGACGCTCCCACTAACCTCCAGTTTGTCAATGAAACTGACAGAACAGTTCTGGTAACGTGGACTCCACCTCGAGCCCGTATAGCAGGCTACCGACTGACCGCGGGCCTGACCCGAGGAGGCCAGCCCAAGCAGTACAATGTGGGACCCTTGGCCTCCAAGTATCCCCTGAGAAATCTGCAGCCTGGGTCTGAGTACACCGTGACCTTGGTGGCTGTGAAAGGGAACCAGCAGAGTCCCAAAGCCACCGGAGTCTTTACTACCCTGCAGCCTCTGCGCTCCATTCCACCTTACAACACCGAGGTGACAGAGACCACAATTGTGATCACCTGGACCCCCGCTCCAAGGATTGGCTTCAAGCTGGGTGTACGACCGAGCCAGGGAGGTGAGGCACCCCGAGAAGTGACTTCAGACTCTGGGAGCATTGTTGTGTCTGGCTTGACTCCAGGCGTGGAATACACTTACACCATCCAAGTCCTGCGAGATGGCCAGGAGAGAGATGCACCGATTGTCAACAGAGTAGTGACACCGCTGTCTCCACCGACCAACTTGCATCTGGAGGCAAACCCTGACACTGGAGTGCTTACTGTCTCCTGGGAGAGGAGCACTACCCCAGATATCACTGGCTACAGAATAACTACTACCCCCACGAACGGGCAGCAGGGGACCTCTCTGGAAGAAGTGGTCCATGCTGATCAGAGTTCCTGCACTTTTGAGAACCTGAATCCTGGCCTGGAGTACAACGTCAGTGTTTACACTGTCAAAGATGACAAGGAAAGTGCCCCTATCTCTGATACCGTTGTCCCAGAGGTGCCCCAGCTCACTGACCTAAGCTTTGTTGATATAACTGATTCAAGCATCGGCCTGAGGTGGACCCCGCTAAACTCTTCCACCATTATCGGGTACCGAATCACAGTAGTTGCGGCAGGAGAAGGGATCCCTATTTTTGAAGATTTTGTGGACTCCTCAGTAGGATACTACACAGTTACAGGGCTGGAGCCTGGCATTGACTATGACATCAGCGTTATCACTCTCATTAATGGCGGAGAGAGTGCCCCTACTACACTGACACAGCAAACGGCTGTCCCTCCTCCCACGGATCTGCGATTCACCAATATCGGTCCAGACACGATGCGGGTCACTTGGGCCCCGCCTCCGTCCATCGAGCTGACCAACCTCTTGGTGCGCTACTCACCCGTGAAGAATGAAGAGGACGTTGCAGAGCTATCCATTTCACCTTCAGACAATGCCGTGGTCCTAACAAATCTCCTGCCTGGGACAGAATACTTAGTCAGTGTCTCCAGTGTCTACGAACAACATGAGAGCATCCCTCTCCGGGGAAGGCAGAAAACAGGTCTCGATTCCCCAACTGGTTTTGATTCTTCTGATATCACCGCCAACTCATTCACTGTCCACTGGGTGGCTCCTCGGGCCCCCATCACCGGCTACATCATCCGCCATCACGCCGAGCATTCTGTCGGAAGACCCAGGCAGGATCGAGTGCCGCCCTCGCGGAATTCCATCACCCTCACCAACCTTAATCCGGGCACCGAGTACGTTGTCAGCATCATTGCTGTTAATGGCAGAGAGGAGAGCCCGCCACTGATTGGCCAGCAAGCCACAGTTTCTGATATTCCGAGAGATCTGGAGGTCATTGCCTCCACCCCCACCAGCCTGCTCATCAGTTGGGAACCCCCTGCCGTCTCTGTGCGCTATTACAGAATCACCTACGGAGAGACAGGAGGAAATAGCCCTGTCCAGGAGTTCACTGTGCCCGGAAGCAAGTCCACAGCCACCATCAACAACATTAAACCAGGAGCAGACTACACCATCACCCTGTATGCTGTCACTGGCCGTGGGGACAGTCCAGCAAGCAGCAAGCCAGTTTCCATCAATTATAAAACAGAAATTGACAAGCCGTCCCAGATGCAGGTGACAGATGTCCAGGACAACAGCATCAGTGTCAGGTGGCTGCCTTCAACTTCTCCTGTGACAGGCTACAGAGTGACCACCACTCCCAAAAATGGCCTAGGACCATCAAAAACTAAAACTGCCAGTCCAGATCAAACAGAAATGACCATTGAAGGTTTGCAACCCACTGTGGAGTACGTGGTTAGTGTTTATGCTCAGAACCGGAACGGAGAAAGCCAGCCCCTGGTTCAAACTGCAGTGACCAACATTGATCGCCCTAAAGGACTGGCATTCACTGATGTGGATGTCGATTCCATCAAAATTGCTTGGGAAAGCCCACAGGGGCAAGTTTCCAGGTACAGGGTGACCTACTCGAGCCCTGAGGATGGAATCCGGGAGCTTTTCCCTGCACCTGATGGTGAAGACGACACTGCAGAGCTGCAGGGCCTCAGGCCGGGGTCTGAGTACACAGTCAGTGTGGTTGCCTTGCACGATGATATGGAGAGCCAGCCCCTGATTGGAATCCAGTCCACAGCCATTCCTGCGCCCACCAATCTGAAGTTCAGTCAGGTGACACCCACCAGCTTTACTGCCCAGTGGATAGCACCCAGTGTTCAGCTCACTGGCTACCGGGTGCGGGTGAACCCGAAAGAGAAGACAGGACCAATGAAAGAAATCAACCTTTCTCCAGACAGCTCATCGGTGATTGTGTCAGGACTCATGGTGGCCACTAAATACGAAGTCAGTGTCTATGCTCTCAAGGACACACTGACAAGCAGACCAGCCCAGGGAGTCATCACTACTCTGGAGAATGTTAGCCCTCCAAGAAGGGCCCGTGTGACGGACGCTACAGAGACCACCATCACTATTAGCTGGAGAACAAAGACAGAGACAATCACTGGCTTCCAAGTCGATGCCATCCCAGCCAATGGCCAGACCCCAGTTCAGAGGAGCATCAGCCCGGATGTTAGAAGCTACACCATTACAGGTTTACAGCCAGGCACTGACTACAAGATCCACCTGTACACTCTGAACGACAATGCCCGGAGCTCGCCCGTGATCATCGATGCCTCCACCGCCATCGACGCACCATCCAACCTGCGGTTCCTGACCACCACACCCAACTCCTTGCTGGTGTCATGGCAGGCGCCCCGTGCCAGGATTACTGGCTACATTATCAAGTATGAGAAGCCTGGATCCCCTCCCAGAGAAGTGGTCCCTCGGCCCCGCCCTGGTGTCACGGAGGCCACCATTACTGGTCTGGAGCCAGGAACCGAGTACACCATCTACGTCATTGCCCTGAAGAACAATCAGAAGAGTGAGCCCCTGATTGGGAGGAAGAAGACAGTTCAAAAGACCCCCTTCATCACCAACCCTGGGTATGACACCGAAAATGGTATTCAGCTTCCTGGCACAACCCACCAGCAACCCAGTGTTGGGCAACAAATGATCTTTGAGGAACATGGCTTTAGGCGGACAACGCCACCCACTGCGGCCACCCCCGTCAGGCTTAGGCCAAGACCATACCTGCCGAATGTAGATGAGGAGGTCCAAATCGGTCATGTTCCCAGGGGAGACGTAGACTACCACCTCTATCCTCATGTTCCGGGCCTCAATCCAAATGCCTCTACAGGACAGGAAGCTCTCTCTCAGACAACCATCTCTTGGACGCCGTTCCAGGAGAGTTCTGAGTACATCATTTCATGCCAACCAGTTGGCACCGACGAAGAGCCCTTACAGTTCCAAGTTCCTGGAACTTCTACCAGTGCGACTCTGACTGGCCTTACCAGAGGGGTCACCTACAACATCATAGTGGAGGCACTGCAGAACCAGAGGAGGCACAAGGTTCGGGAAGAGGTTGTGACTGTGGGCAACGCTGTCAGCGAAGGCCTGAACCAGCCTACAGATGACTCATGCTTTGACCCTTACACGGTTTCCCATTACGCCATTGGAGAGGAGTGGGAGCGGTTGTCTGACGCTGGCTTTAAGCTCACATGCCAGTGCTTGGGCTTTGGCAGTGGTCATTTCAGATGCGATTCATCTAAATGGTGCCATGACAACGGTGTCAACTACAAGATCGGAGAGAAGTGGGATCGGCAGGGAGAAAATGGCCAGCGGATGAGCTGCACATGCCTCGGGAATGGAAAGGGAGAATTCAAGTGTGATCCCCATGAAGCAACGTGCTATGACGATGGGAAGACCTACCATGTAGGAGAACAGTGGCAGAAAGAATATCTCGGAGCCATTTGCTCCTGCACGTGTTTCGGAGGCCAGCGGGGCTGGCGCTGTGACAACTGCCGTAGACCTGGGGCTGCTGAACCCAGTCCCGATGGCACCACCGGCCACACCTACAACCAGTATACACAGAGATACAATCAGAGAACAAACACTAACGTAAATTGCCCCATTGAGTGCTTCATGCCGCTAGATGTGCAAGCTGACAGAGACGATTCTCGAGAGTAATCTTTCCAGCCCCACCCTACAAGTGTCTCTCTACCAAGGTCAATCCACACCCCAGTGATGTTAGCAGACCCTCCATCTTTGAGTGGTCCTTTCACCCTTAAGCCTTTTGCTCTGGAGCCATGTTCTCAGCTTCAGCACAATTTACAGCTTCTCCAAGCATCGCCCCGTGGGATGTTTTGAGACTTCTCTCCTCAATGGTGACAGTTGGTCACCCTGTTCTGCTTCAGGGTTTCAGTACTGCTCAGTGTTGTTTAAGAGAATCAAAAGTTCTTATGGTTTGGTCTGGGATCAATAGGGAAACACAGGTAGCCAACTAGGAGGAAATGTACTGAATGCTAGTACCCAAGACCTTGAGCAGGAAAGTCACCCAGACACCTCTGCTTTCTTTTGCCATCTGACCTGCAGCACTGTCAGGACATGGCCTGTGGCTGTGTGTTCAAACACCCCTCCCACAGGACTCACTTTGTCCCAACAATTCAGATTGCCTAGAAATACCTTTCTCTTACCTGTTTGTTATTTATCAATTTTTCCCAGTATTTTTATACGGAAAAAATTGTATTGAAGACACTTTGTATGCAGTTGATAAGAGGAATTCAGTATAATTATGGTTGGTGATTATTTTTATAAGCACATGCCAACGCTTTACTACTGTGGAAAGACAAGTGTTTTAATAAAAAGATTTACATTCCA