Transcript asmbl_25269

Sequence
Transcript Sequence for observation asmbl_25269 of TGE0000815:
AAAGGCGGAAGCGGAAGTCGGGGGGCGCGCCAGCTCGTAGCAGGGGAGCGCCCGCGGCGTCGGGTTTGGGCTGGAGGTCGCCATGGGGCGAGGCAGCGGCACCTTCGAGCGTCTCCTAGACAAGGCGACCAGCCAGCTCCTGTTGGAGACAGATTGGGAGTCCATTTTGCAGATCTGCGACCTGATCCGCCAAGGGGACACACAAGCAAAATATGCTGTGAATTCCATCAAGAAGAAAGTCAACGACAAGAACCCACACGTCGCCTTGTATGCCCTGGAGGTCATGGAATCTGTGGTAAAGAACTGTGGCCAGACAGTTCATGATGAGGTGGCCAACAAGCAGACCATGGAGGAGCTGAAGGACCTGCTGAAGAGACAAGTGGAGGTAAACGTCCGTAACAAGATCCTGTACCTGATCCAGGCCTGGGCGCATGCCTTCCGGAACGAGCCCAAGTACAAGGTGGTCCAGGACACCTACCAGATCATGAAGGTGGAGGGGCACGTCTTTCCAGAATTCAAAGAGAGCGATGCCATGTTTGCTGCCGAGAGAGCCCCAGACTGGGTGGACGCTGAGGAATGCCACCGCTGCAGGGTGCAGTTCGGGGTGATGACCCGTAAGCACCACTGCCGGGCGTGTGGGCAGATATTCTGTGGAAAGTGTTCTTCCAAGTACTCCACCATCCCCAAGTTTGGCATCGAGAAGGAGGTGCGCGTGTGTGAGCCCTGCTACGAGCAGCTGAACAGGAAAGCGGAGGGAAAGGCCACTTCCACCACTGAGCTGCCCCCCGAGTACCTGACCAGCCCCCTGTCTCAGCAGTCCCAGCTGCCCCCCAAGAGGGACGAGACGGCCCTGCAGGAGGAGGAGGAGCTGCAGCTGGCCCTGGCGCTGTCACAGTCAGAGGCGGAGGAGAAGGAGAGGCTGAGACAGAAGTCCACGTACACTTCGTACCCCAAGGCGGAGCCCATGCCCTCGGCCTCCTCAGCGCCCCCCGCCAGCAGCCTGTACTCTTCACCTGTGAACTCGTCGGCGCCTCTGGCTGAGGACATCGACCCTGAGCTCGCACGGTATCTCAACCGGAACTACTGGGAGAAGAAGCAGGAGGAGGCTCGCAAGAGCCCCACGCCATCTGCGCCCGTGCCCCTGACGGAGCCGGCTGCACAGCCTGGGGAAGGGCACGCAGCCCCCACCAACGTGGTGGAGAACCCCCTCCCGGAGACAGACTCTCAGCCCATTCCTCCCTCTGGTGGCCCCTTTAGTGAGCCACAGTTCCACAATGGCGAGTCTGAGGAGAGCCACGAGCAGTTCCTGAAGGCGCTGCAGAACGCCGTCACCACCTTCGTGAACCGCATGAAGAGTAACCACATGCGGGGCCGCAGCATCACCAATGACTCGGCCGTGCTCTCACTCTTCCAGTCCATCAACGGCATGCACCCGCAGCTGCTGGAGCTGCTCAACCAGCTGGACGAGCGCAGGCTGTACTATGAGGGGCTGCAGGACAAGCTGGCACAGATCCGCGATGCCCGGGGGGCGCTGAGTGCCCTGCGCGAAGAGCACCGGGAGAAGCTTCGCCGGGCAGCCGAGGAGGCAGAGCGCCAGCGCCAGATCCAGCTGGCCCAGAAGCTGGAGATAATGCGGCAGAAGAAGCAGGAGTACCTGGAGGTGCAGAGGCAGCTGGCCATCCAGCGCCTGCAGGAGCAGGAGAAGGAGCGGCAGATGCGGCTGGAGCAGCAGAAGCAGACGGTCCAGATGCGCGCGCAGATGCCCGCCTTCCCCCTGCCCTACGCCCAGCTCCAGGCCATGCCCGCAGCCGGAGGTGTGCTCTACCAGCCCTCGGGACCAGCCAGCTTCCCCAGCACCTTCAGCCCTGCCGGCTCGGTGGAGGGCTCCCCAATGCACGGCGTGTACATGAGCCAGCCGGCCCCTGCCGCTGGCCCCTACCCCAGCATGCCCAGCACTGCGGCTGATCCCAGCATGGTGAGTGCCTACATGTACCCAGCAGGGGCCACTGGGGCGCAGGCGGCCCCCCAGGCCCAGGCCGGACCCACCGCCAGCCCCGCTTACTCATCCTACCAGCCTACTCCCACAGCGGGCTACCAGAACGTGGCCTCCCAGGCCCCACAGAGCCTCCCGGCCATCTCTCAGCCTCCGCAGTCCAGCACCATGGGCTACATGGGGAGCCAGTCAGTCTCCATGGGCTACCAGCCTTACAACATGCAGAATCTCATGACCACCCTCCCAAGCCAGGATGCGTCTCTGCCACCCCAGCAGCCCTACATCGCGGGGCAGCAGCCCATGTACCAGCAGATGGCACCCTCTGGCGGTCCCCCCCAGCAGCAGCCCCCCGTGGCCCAGCAACCGCAGGCACAGGGGCCGCCGGCACAGGGCAGCGAGGCCCAGCTCATTTCATTCGACTGACCCAGGCCATGCTCACGTCCGGAGTAACACTACATACAGTTCACCTGAAACGCCTCGTCTCTAACTGCCGTCGTCCTGCCTCCCTGTCCTCTACTGCCGGTAGTGTCCCTTCTCTGCGAGTGAGGGGGGGCCTTCACCCCAAGCCCACCTCCCTTGTCCTCAGCCTACTGCAGTCCCTGAGTTAGTCTCTGCTTTCTTTCCCCAGGGCTGGGCCATGGGGAGGGAAGGACTTTCTCCCAGGGGAAGCCCCCAGCCCTGTGGGTCATGGTCTGTGAGAGGTGGCAGGAATGGGGACCCTCACCCCCCAAGCAGCCTGTGCCCTCTGGCCGCACTGTGAGCTGGCTGTGGTGTCTGGGTGTGGCCTGGGGCTCCCTCTGCAGGGGCCTCTCTCGGCAGCCACAGCCAAGGGTGGAGGCTTCAGGTCTCCAGCTTCTCTGCTTCTCAGCTGCCATCTCCAGTGCCCCAGAATGGTACAGCGATAATAAAATGTATTTCAGAAAGCA