Transcript asmbl_22754

Sequence
Transcript Sequence for observation asmbl_22754 of TGE0054021:
TCTTCAGCAACAACCACCCGGGAGCTGGCGGTGCTAAGGGGCTCGGGCCTCTGGCGGAGGCTGCAGCGGCCGGAGACGGAGCGGCTGCGGCGGGGGCGGCCCGAGCTCAGTACAGCCTCCCGGGGATCTTGCACTTCCTGCAGCACGAATGGGCCCGCTTCGAGGTGGAGAGAGCCCAGTGGGAGGTGGAGCGGGCGGAGCTGCAGGCTCAGATTGCTTTCCTTCAGGGGGAGAGGAAAGGACAAGAAAATTTGAAGAAAGATCTTGTGAGGAGGATCAAAATGCTGGAATATGCTTTGAAGCAGGAAAGAGCCAAATACCACAAGTTGAAATATGGGACAGAACTGAATCAGGGAGACATGAAGCCTCCAAGCTATGACTCTGATGAAGGTAATGAAACAGAGGTGCAGCCACAGCAAAATAGCCAGTTAATGTGGAAACAAGGCCGGCAGCTACTCAGGCAGTATCTCCAGGAGGTCGGCTACACAGATACTATTCTAGACGTGAAATCCAAGCGTGTGCGGGCATTGTTGGGCTTTTCAAGTGATGTCACTGACAGGGAGGATGACAAAAACCAGGACTCAGTGATAAATGGCACAGAGGCTGAAGTTAAAGAGACAGCAATGATTGGAAAATCCGAGCTAACGGATTCTGCCTCTGTGCTGGACAATTTCAAATTCCTTGAAAGTGCAGCTGCAGATGTCAGTGACGAGGACGAGGACGAGGACACTGATGGAAGAGCCAAGAGTGTCATTGATACTTCCACAATTGTTAGGAAAAAAGCATTGCCTGATACCAGTGAAGATCGAGACACAAAAGAAGCTCTGAAGGAGTTTGACTTTCTTGTCACATCAGAGGAAGGAGACAACGAATCTAGAAGCGCAGGCGATGGAACCGACTGGGAAAAGGAAGATCAGTGTCTCACGCCTGAAGCCTGGAATGTGGACCAGGGAGTGATCTCCAAACTGAAGGAGCAGTACAAAAAGGAGAGGAAGGGGAAGAAGGGGGTGAAGAGGCCCAATAGGTCAAAACTACAAGATATGCTTGCTAATTTGAGAGACGTTGATGAACTTCCCTCCTTGCAGCCATCTGTTGGCTCCCCTTCCAGACCCAGCAGCTCCAGGCTTCCAGAACAGGAGCTCAGTAGGGCAGATGAAGTGGAAGCGCTGACATTCCCCCCTTCTTCTGGGAAGTCATTTATCATGGGAGCAGACGAAGCCCTTGAGAGCGAGCTGGGGCTTGGAGAATTAGCAGGCCTCACGGTGGCCAATGAAGCAGACTCACTAGCTTATGATATAGCGAATAACAAAGATGCCTTGAGGAAGACGTGGAACCCTAAGTTTACATTAAGGAGTCACTTTGATGGCATCCGAGCCCTTGCTTTCCACCCCATTGAGCCTGTGTTAATAACAGCCTCAGAGGACCATACGCTGAAAATGTGGAATCTACAGAAAACAGCCCCAGCCAAAAAGAGTACTTCTCTAGATGTGGAGCCTATCTATACATTCAGGGCTCACAAAGGCCCGGTGCTGTGTGTGGTCATGAGTAGCAATGGTGAGCAGTGCTACAGCGGCGGGACTGACGGGCGGATCCAGAGCTGGAGCACCACCAATCCCAACGTCGATCCCTACGACGCTTACGATCCTTCAGTTCTAAGAGGCCCTCTGCTGGGCCACACGGACGCGGTATGGGGGCTGGCCTACAGTGCGGCACACCAGCGCTTGCTCTCCTGCTCAGCAGACGGCACTCTTCGCTTATGGAATACAACTGAGGTTGCTCCAGCACTGAGTGTATTTAATGATAACCAAGAGCTGGGAATTCCTGCCTCTGTGGATCTGGTGAGCAGCGACCCGAGCCATATGGTAGCATCGTTCAGCAAGGGATATACAAGCATCTTTAACATGGAAACACAGCAGCGAGTTCTCACGCTAGAATCCAATGTTGATTCAACATCCAGTTCTTCCTGCCAAATAAACAGAGTCATCAGCCATCCTACCCTCCCAATCAGCATCACTGCTCATGAAGACAGGCACATCAAGTTCTACGATAACAATACAGGCAAACTGATCCACTCGATGGTGGCCCACCTGGAAGCTGTGACAAGCCTGGCAGTTGACCCGAATGGCCTCTACTTGATGTCTGGCAGTCATGACTGTTCAATACGCTTATGGAATTTAGAAAGTAAGACATGTATCCAGGAGTTCACAGCTCATCGGAAGAAATTTGAAGAATCGATCCACGATGTAGCGTTCCACCCTTCCAAATGCTATATAGCCAGCGCTGGAGCCGACGCCCTGGCTAAGGTCTTTGTATGATGTGGCACAGCAGCTTCACCTTGTAGCTCTTTATAAAAGTCAACTGCACAACAGCGATACGGAAGACCAGGGCAAGAATCAGCTCGCCCTGCCCTTTTGTTCTGCTGAGGGAGCACAG