Transcript asmbl_21744

Sequence
Transcript Sequence for observation asmbl_21744 of TGE0032507:
CGAGCTCCTGCGGCGAGCGGGTGTGACCCCGGCGTCTGGGTTCGGTTCTGAAGTCCGGGCTTGGTCCGGGTGATCCCCAAACACTGACCGTTCTCATTTCCTTTTGGGAGTATTCATGCTTCACCATGTTGAGAGCTAAGAATCAACTTTTTTTGCTATCGCCCCATTACCTGAAGCAGCTAAACATTCCATCAGCTTCCAGATGGAAACGCCTTCTACACCAGCAGCAACCCCTTCACCCAGAATGGGCTGTACTGGCCAAAAAGCAGCTGAAAGGCAAAAACCCAGAGGACCTTATATGGCACACCCCAGAAGGGATCTCTATAAAGCCCTTATATTCCAGGGCAGATACTCTGGACTTACCCGAAGAACTTCCAGGAGTGAAGCCATTCACACGGGGACCATATCCTACCATGTATACCTATAGGCCCTGGACCATCCGTCAGTATGCAGGCTTTAGTACTGTGGAAGAAAGCAATAAATTCTATAAGGACAATATTAAGGCTGGTCAGCAGGGGTTGTCTGTTGCCTTTGACTTGGCAACACATCGTGGTTATGATTCAGACAACCCCAGAGTTCGTGGAGATGTTGGAATGGCTGGAGTTGCTATTGACACTGTAGAAGACACCAAAATCCTATTTGATGGCATTCCTTTAGAAAAAATGTCCGTTTCCATGACTATGAACGGAGCTGTCATCCCAGTCCTGGCAACATTTATAGTAACTGGGGAAGAGCAAGGTGTGCCGAAGGAGAAGCTCACTGGCACAATTCAGAATGACATCCTAAAGGAGTTTATGGTCAGAAATACTTATATTTTTCCCCCAGAGCCATCGATGAAAATTATTGCTGACATTTTCCAATACACAGCACAGCACATGCCAAAATTTAATTCCATTTCGATTAGCGGGTACCATATGCAGGAAGCAGGAGCTGATGCCATTTTAGAACTGGCCTATACCATCGCAGATGGGTTGGAGTACTGCAGAACTGGACTCCAGGCTGGACTCACAATTGATGAATTTGCACCAAGGTTGTCTTTCTTCTGGGGAATTGGAATGAACTTCTACATGGAAATAGCCAAGATGCGAGCTGGGAGAAGACTGTGGGCTCACTTAATAGAAAAAATGTTCCAGCCTAAAAACTCTAAATCTCTTCTTCTAAGAGCACACTGCCAGACATCGGGGTGGTCACTTACTGAGCAGGATCCTTACAATAACATTGTCCGCACTGCAATCGAAGCCATGGCAGCTGTGTTTGGAGGAACCCAGTCTTTGCATACGAACTCTTTTGATGAAGCGCTGGGTTTGCCCACTGTGAAAAGTGCCCGGATTGCTCGGAACACACAGATCATCATTCAGGAAGAATCTGGGATCCCCAAAGTGGCGGATCCTTGGGGAGGGTCGTACATGATGGAGTCGCTCACAAATGACGTTTATGAGGCTGCTCTGAAGTTGATATATGAAGTTGAAGAAATGGGTGGAATGGCCAAAGCTGTAGCTGAAGGAATCCCTAAACTTCGCATTGAAGAATGTGCTGCCCGAAGACAAGCTAGAATAGATTCTGGTTCTGAGGTAATTGTTGGAGTAAATAAGTATCAGTTGGAAAAAGAAGACTCTGTGGAGGTCCTGGCCATTGACAACACTTCAGTGCGTAAGAAGCAGATTGAAAAACTCAAGAAGATTAAATCCAGCAGGGATCAAGCTTTGGCTGAGCAGTGTCTCAGTGCACTTACCCAGTGTGCTGCCAGTGGAGATGGCAATATTCTGGCTCTGGCAGTGGATGCAGCTCGTGCAAGATGTACAGTTGGAGAAATCACGGATGCCTTGAAAAAAGTATTTGGTGAGCATAAAGCTAATGATCGTATGGTGAGTGGAGCATATCGGCAGGAGTTTGGAGAAAGTAAAGAGATCACATCTGCCATCAAGAGAGTTAATAAATTCATGGAACGTGAAGGTCGCAGACCTCGTCTTCTTGTGGCAAAAATGGGACAAGATGGCCATGACAGGGGAGCCAAGGTCATTGCTACAGGATTTGCTGATCTTGGTTTTGATGTGGACATAGGCCCTCTTTTTCAGACTCCCCGTGAAGTGGCGCAGCAAGCTGTGGATGCAGATGTCCATGCTGTGGGTGTCAGCACACTTGCTGCTGGTCATAAAACCCTCGTTCCTGAGCTTATCAAAGAACTCACCGCCCTGGGGCGGCCAGATATCCTTGTCATGTGTGGGGGCGTGATTCCACCACAGGATTATGAATTTCTGTATGAAGTTGGTGTTTCCAACGTCTTTGGTCCTGGAACCCGGATTCCAAGAGCTGCTGTCCAAGTGCTTGATGATATTGAGAAGTGTTTGGCAGAGAAGCAGCAGTCTGTGTAACATCTGGATCTTTAGTTATGACTGAAG