Transcript asmbl_21727

Sequence
Transcript Sequence for observation asmbl_21727 of TGE0053913:
CCGCTCGCTGCTGACGTCACCGCGGCCCCGCCTCCCCAGGGCCCCGGGCCGCCGGCGGGGGCTGCCCCGGGGAGTCAGTTGCGGCGGCGGGGAGCTCGGCGGAGGGCGGGCCGGGGCTCCGGGGCCATGCCGAGGAAGAAGCCCTTCAGCGTGAAGCAGAAGAAGAAGCAGCTGCAGGACAAGCGGGAGCGGAAGCGAGGGCTCCAAGATGGGCTGCGCTCCAGTTCCAACAGCCGCAGCGGTAGCCGGGAGCGGCGGGAGGAGCAGACGGACACGTCGGATGGGGAATCCGTGACCCATCATATCCGCAGGCTCAACCAGCAACCTTCCCAGGGCCTGGGGCCCAGAGGCTACGACCCCAACCGATACCGGCTGCATTTTGAACGGGACAGCCGGGAGGAGGTGGAGAGGAGAAAGAGAGCGGCCAGAGAGCAAGTGTTGCAGCCGGTCAGTGCTGAAGTGTTAGAGTTGGATATCCGGGAAGTGTATCAGCCTGGCTCAGTCCTGGACTTTCCCCGGCGGCCTCCTTGGAGTTATGAGATGTCCAAGGAACAGCTAATGAGCCAGGAGGAGCGGAGCTTCCAGGAATACCTTGGGAAGATACACGGGGCATACACTTCAGAGAAACTCAGCTACTTTGAGCACAATCTGGAGACATGGAGGCAGCTGTGGCGGGTGTTAGAGATGTCTGACATCGTCCTGCTCATTACTGACATCCGACATCCGGTTGTGAACTTCCCACCAGCACTTTACGAGTATGTAACTGGAGAGCTTGGGCTGGCCCTGGTGCTGGTCTTGAACAAGGTGGACCTGGCCCCGCCGGCTCTCGTGGTTGCCTGGAAGCATTATTTTCACCAGTGCTACCCCCAGCTCCACATTGTCTTGTTCACCTCTTTCCCTCGGGACACGCGCACTCCACAGGAGCCTGGTGGTGTCTTGAAGAAGAATCGGAGACGGGGGAAAGGATGGACTCGGGCACTGGGACCAGAGCAGTTGCTGAGAGCCTGTGAAGCTATCACTGTGGGGAAAGTGGACTTGAGCAGCTGGCGCGAGAAGATTGCTAGGGACGTGGCTGGAGCCTCCTGGGGTAACGTCTCCGGTGAGGAAGAGGAGGAGGAAGACGGGCCAGCAGTACTGGTAGAGCAGCTGACCGACTCAGCCATGGAGCCCACAGGCCCCTCCAGGGAGCGCTACAAGGATGGGGTGGTGACTATTGGCTGTATAGGTTTCCCCAATGTGGGGAAGTCCTCTCTGATCAACGGGCTGGTGGGGCGGAAGGTGGTGAGTGTCTCCAGAACGCCAGGCCACACCCGGTATTTTCAGACCTACTTTCTGACCCCCTCTGTGAAGCTCTGTGACTGCCCGGGCCTTATCTTCCCCTCGCTGCTGCCCAGGCAGCTGCAGGTTCTGGCTGGAATCTACCCCATTGCCCAGATCCAGGAGCCCTACACTTCTGTGGGCTACCTGGCCTCCAGAATCCCCGTGCAGGCCCTGCTGCACCTGCGCCACCCAGAGGCAGAGGACCCTTCGGCTGAGCACCCCTGGTGTGCCTGGGACATCTGTGAAGCTTGGGCAGAGAAACGTGGTTATAAAACGGCCAAGGCAGCTCGAAATGACGTGTACAGAGCGGCCAATAGCCTACTTCGCCTGGCAGTGGATGGCCGCCTCAGCCTATGTTTCTACCCTCCTGGTTACAGCGAACAGAGAGGCACCTGGGAGTCTCACCCAGAGACTGCAGAGCTGGTGCTGTCGCAGGGCAGGGTGGGGCCGGCAGGTGAT