Transcript asmbl_21

Sequence
Transcript Sequence for observation asmbl_21 of TGE0053860:
CGCCGCCGCCGCCGCCTCCTCCGCGTCCATGTATGAGGGCAAGAAGACGAAGAACATGTTCCTGACCCGGGCCCTGGAGAAGATTCTGGCCGACAAGGAAGTGAAGAAGGCGCATCACTCCCAGCTGCGCAAAGCGTGCGAGGTGGCCCTAGAGGAAATAAAAGTTGAAACTGAGAAACAAAGCCCTCCTCATGGAGAAGCAAAAGCTGGATCAGGCACCCTTCCACCAGTGAAATCAAAGACAAATTTTATTGAAGCAGACAAGTACTTTTTACCCTTTGAGTTGGCATGCCAGTCCAAATGTCCCCGCATAGTTAGTACATCTCTAGATTGTTTGCAGAAACTTATTGCTTATGGGCACTTGACTGGCAGGGCTCCAGATAGTACGACACCAGGCAAAAAATTAATTGATAGAATTATTGAAACAATATGTGGCTGCTTCCAAGGTCCTCAAACAGATGAAGGAGTTCAGTTGCAGATAATAAAGGCTTTACTTACCGCAGTGACATCACAACACATAGAAATCCATGAAGGAACTGTGCTGCAAGCTGTGAGGACATGCTACAATATCTATTTAGCCAGCAAAAATCTCATCAATCAGACAACAGCCAAAGCTACTCTTACTCAAATGCTGAACGTTATCTTTGCACGCATGGAAAACCAAGCATTACAGGAGGCCAAACAAATGGAAAGAGAAAGACATCGGCAGCAGCAGCATTTGTTACAGTCTCCAGTAAGCCATCATGAGCCCGAGTCACCTCATCTTAGATATTTGCCACCTCAGACTGTTGATCATATAAACCAAGAGCATGAAGGGGATCTTGAGCCCCAAACACATGATGTGGATAAAAGTCTCCAAGATGATACAGAGCCTGAAAACGGATCTGATATTTCCAGTGCAGAAAATGAACAGACAGAAGCTGATCAGGCAACTGCAGCTGAAACATTATCTAAAAATGATATCTTGTATGATGGAGACTATGAAGAAAAGCCACTTGATATTGTCCAGAGCATTGTAGAAGAAATGGTGAACATCATTGTTGGAGACATGGGAGAAGGGATGGCTATCAGTGCAAGTACAGAAGGCAACACTGGAACTGTAGAAGATGGTAGTGACAGTGAAAACATCCAAGCAAATGGAATCCCAGGAACACCCATTTCTGTTGCATATACACCATCGTTACCTGACGACAGGTTATCTGTCTCCTCCAATGATACTCAGGAATCTGGAAATTCTTCAGGACCTTCACCTGGTGCTAAGTTTTCCCACATTTTACAAAAGGATGCCTTTCTAGTGTTCAGGTCATTGTGTAAGCTGTCAATGAAACCACTGTCAGATGGACCACCAGATCCAAAGTCTCATGAGTTACGGTCCAAGATTCTTTCATTGCAGTTGCTTCTGTCCATTCTGCAGAATGCAGGACCTGTTTTCAGGACAAATGAGATGTTTATTAATGCTATCAAGCAGTATCTATGTGTTGCACTCTCAAAAAACGGAGTCTCATCTGTTCCAGAGGTTTTTGAGCTTTCTCTTTCCATATTTCTTACTTTGTTGTCAAACTTCAAGACACATCTGAAGATGCAAATTGAGGTATTCTTTAAAGAAATCTTCCTGTACATTTTGGAAACGTCTACAAGCTCATTTGACCATAAGTGGATGGTTATTCAGACACTGACAAGGATCTGTGCAGATGCTCAGAGTGTGGTGGACATTTATGTAAATTATGACTGTGACCTAAATGCAGCAAATATATTTGAAAGACTAGTAAATGACCTGTCGAAAATTGCCCAAGGAAGGGGCAGCCAAGAACTTGGTATGAGTAATGTTCAGGAATTGAGCCTGCGAAAAAAGGGGTTAGAATGTTTAGTTTCAATTTTGAAATGTATGGTTGAATGGAGCAAGGATCAGTATGTGAACCCCAACTCTCAAACTACCCTTGGTCAGGAAAAACCCTCAGAGCAAGAGATAAGTGAAGTTAAACACCCAGAGACTATAAACAGATATGGAAGTTTAAACTCCTTAGAATCCACATCATCATCAGGAATTGGCAGCTACAGTACACAGATGTCTGGCACTGATAATCCAGAACAATTTGAGGTCCTAAAGCAGCAAAAAGAAATAATAGAACAAGGGATTGATTTATTTAATAAGAAACCAAAGAGAGGAATACAATACCTCCAAGAACAAGGGATGCTTGGCACCACACCCGAAGATATAGCTCAGTTCTTACATCAAGAAGAAAGATTAGACTCTACTCAGGTGGGTGAGTTCCTGGGAGATAATGATAAATTCAATAAAGAAGTCATGTATGCATATGTAGACCAACATGACTTTTCAGGAAAAGACTTTGTTTCAGCTCTTCGTCTATTTCTGGAAGGATTCCGGCTTCCAGGAGAAGCTCAGAAAATTGATCGATTAATGGAAAAATTTGCTGCAAGATACCTAGAGTGCAACCAAGGACAAACCCTTTTTGCTAGTGCAGATACTGCTTATGTTTTGGCCTACTCAATTATCATGTTGACTACAGACCTTCACAGTCCACAGGTTAAAAACAAAATGACAAAAGAACAGTACATTAAAATGAATCGTGGTATCAATGACAGTAAAGATCTCCCTGAAGAGTATCTATCAGCCATTTATAACGAAATAGCTGGGAAAAAAATATCAATGAAAGAAACAAAAGAACTAACAATCCCTACAAAGTCAACTAAACAGAATGTAGCCAGTGAAAAGCAAAGACGACTTCTGTATAACTTAGAAATGGAACAGATGGCCAAGACGGCTAAAGCACTCATGGAAGCTGTGAGCCATGTTCAGGCACCTTTTACAAGTGCAACACACTTGGAGCACGTGAGGCCGATGTTTAAGTTGGCTTGGACACCTTTTCTGGCTGCATTCAGTGTGGGTCTCCAAGACTGTGATGATACTGAAGTAGCCTCTCTTTGCCTAGAAGGGATAAGATGTGCTATCAGGATTGCATGCATTTTCAGCATTCAGCTGGAAAGAGATGCATATGTCCAAGCACTAGCCAGATTTACCTTACTTACAGTGAGTTCTGGTATTACTGAAATGAAACAGAAGAATATCGACACAATAAAAACACTCATCACGGTGGCTCACACTGATGGAAATTATTTAGGAAATTCGTGGCATGAGATCCTGAAGTGCATCAGTCAGTTAGAGCTGGCACAACTTATAGGAACTGGAGTGAAGCCTCGGTACATTTCTGGGACTGTGAGAGGCAGAGAAGGGTCTCTCACTGGGACAAAAGATCAGGCTCCAGATGAATTTGTTGGTCTAGGGCTAGTTGGAGGAAATGTGGACTGGAAGCAGATAGCCAGTATTCAGGAGTCTATTGGAGAAACCAGCTCTCAAAGTGTGGTAGTTGCTGTGGATAGAATATTCACCGGATCCACAAGGCTAGATGGAAATGCTATTGTTGATTTTGTCCGTTGGCTATGTGCTGTGTCTATGGATGAATTGCTTTCTACTACACACCCAAGAATGTTTAGTCTACAAAAAATAGTAGAAATATCATACTATAACATGGGAAGAATAAGACTGCAGTGGTCTCGGATTTGGGAAGTTATTGGAGATCATTTTAATAAGGTTGGTTGCAATCCTAATGAAGATGTAGCCATATTTGCAGTAGACTCTCTGAGGCAGCTATCAATGAAGTTTTTAGAGAAAGGAGAGCTTGCAAACTTCAGATTCCAAAAGGATTTCTTACGACCTTTTGAACATATAATGAAACGAAACAGGTCTCCAACAATTCGAGATATGGTTGTACGGTGTATAGCACAAATGGTTAATTCTCAGGCTGCAAATATTCGTTCAGGATGGAAGAACATTTTCTCAGTATTCCATCTAGCTGCATCAGACCAAGATGAAAGCATAGTAGAACTTGCATTTCAGACAACAGGGCACATTGTCACTCTTGTATTTGAAAAACACTTTCCGGCCACCATTGATTCTTTCCAGGATGCAGTGAAGTGTTTGTCTGAATTCGCATGTAATGCAGCTTTCCCAGACACAAGCTTTCAAGGAGTACACAAGTGATGACATGAGCGTGGCACCTGAAGACAGGGTGTGGGTGAGAGGGTGGTTCCCGATCCTCTTTGAGTTGTCTTGTATCATCAATAGATGCAAATTAGATGTAAGAACCAGGGGCTTAACAGTAATGTTTGAAATAATGAAAACATATGGCCACACTTATGAAAAACATTGGTGGCAGGACTTATTCAGAATTGTTTTCAGAATCTTTGACAACATGAAATTGCCAGAACAGCAGACAGAGAAAGCTGAATGGATGACAACAACTTGTAACCATGCCCTTTATGCAATATGTGATGTATTCACCCAGTATTTAGAAGTTCTCAGCGATGTACTTTTGGATGATATTTTTGCCCAGCTTTACTGGTGTGTACAACAAGACAATGAGCAGTTAGCACGATCTGGTACAAACTGCTTAGAAAACGTGGTTATTCTGAATGGTGAAAAGTTTACTCTTGAAATCTGGGATAAAACGTGTAACTGCACCCTGGATATCTTCAAAACCACAATTCCTCACGCGCTTCTGACTTGGCGTCCCACCTCTGGCGAGGCCGAACCCCCATCTCCATCAGCTGTGAGTGAAAAGCCGTTGGATGCAATATCACAAAAATCTGTAGACATACATGATTCTATTCAACCAAGATCTTCAGATAACAGACAGCAAGCACCACTGGTTTCTGTTTCTACTGTGAGTGAAGAAGTTAGCAAAGTGAAATCCACAGCAAAATTCCCAGAACAAAAATTGTTTGCTGCCCTGTTGATTAAATGTGTTGTGCAGCTGGAACTCATCCAGACCATCGACAACATTGTCTTCTTCCCAGCCACAAGCAAGAAGGAGGATGCAGAGAACTTAGCTGCAGCCCAGAGAGATGCAGTAGACTTCGATGTTCGAGTTGATACTCAAGACCAAGGAATGTACCGCTTTTTAACATCACAACAACTGTTCAAGCTACTGGACTGCTTATTAGAGTCGCATAGATTTGCAAAAGCATTTAATTCCAACAATGAACAGAGGACTGCTCTGTGGAAAGCAGGCTTCAAAGGCAAGTCCAAGCCCAATCTTCTAAAACAGGAGACAAGCAGCCTGGCGTGTGGGCTGCGCATTCTCTTCCGGATGTACATGGACGAGAGCAGAGTCAGTGCCTGGGAAGAAGTCCAGCAGAGGCTTTTAAACGTCTGCAGGGAAGCGCTGAGCTACTTCCTCACTCTAACATCCGAAAGTCACCGGGAAGCCTGGACTAACTTACTGTTACTGTTCCTCACTAAAGTTCTGAAGATCAGTGACAGCAGGTTTAAAGCTCACGCATCATTCTACTACCCTCTCTTATGTGAAATTATGCAATTTGACTTGATTCCGGAACTGCGTGCTGTTCTTAGAAGATTTTTCCTGCGAATTGGAATAGTATTTCAAATATCACAACCACCTGAACAGGAACTTGGGATAAACAGGCAATGATGAGAGCCGATGTTTTTCTGTTGGTGTTTACATTGCTCTGCTCTGTGAAAGGATCCTGCAGCAGAGGCTTCCTACCTGAAAAATGTTTCTCTCAATTGTAGTGTGTGAGTTACTGGTAAGACGCTTACACCTATAACTCAAGGTCGGAATAGTCCCTCCAGTCCCTTTAGTAACCCAGTGGCCTCTGTCTCGTGTTGGGCTCATGTTGAGCAGAAAGGCTGTTCCCACAGCATCAGCCTACCTTTAGGGTCCTTCCCTGTCCTCTAAGCAGGGTGAGCCCACACTGTGGCAGGTACGGAAATTACCCAAAGAAGTATAGATGTAAAGACTGAGCTTCTGCGAGAAGTACAACTCAGGAGAGCTGTATTTTGAAGGATAAAATGTTTATAATTGGGGGTGGGGGAAGGGAGAAAAAAATTATTGCTCATGGTAAAAGATATTTAGCAACTATGGTATTCTTACTCTGAAGATTTTTGCACACTCAGGCTATCTGAGACACCGGAAATCATCATCTTTCTGTGAAAATGTACAGAGATGCAGGTCTGTAATATAAAAATCTTAAACATATTGTTCCTCCTGCACTGTTTTATTTCTTTATTTTCTTATCTACTTGCTAAATACCCATAATATTTTGTCAAATGCACTAAAACATTTGGGTTGAACTTTTAGTCTTTGGGGGAGTGGTGGTCATTTTGAGGGCTTGCTGTGCCCTGAATCTGTTGTGGCTGATGCCTGTCAAGATGACAACAGGAGGGGATCCACCAAGGTAGAAAACATCCCTGCTGACAAGACCTACCTGTGACATACTCACTCTCTTAGGGCTTTTAAAGACAAGCCATTAAAATAGATGACCTTTCACAGACTGAAAC