Transcript asmbl_20048

Sequence
Transcript Sequence for observation asmbl_20048 of TGE0031448:
CGCTGAGTGGGTTTTCGGATCATGTCTGGTGGCTCCGCGGATTACAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGGTAAGGAGTGGGTGTGGACGTTAAAGGTTTGGAAAGGTACATTTTTTTTTCATGTCTTATTCATAGTTTCATTATTAACTTACAGAGCAACTGGAATGAAATTGTTGATAACTTTGATGATATGAATTTAAAGGAGTCCCTTCTTCGAGGCATCTATGCATATGGTTTTGAGAAGCCTTCAGCTATTCAGCAAAGAGCTATTATCCCTTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTTTGGCTCTTGGAGATTATATGGGAGCAACTTGTCATGCTTGCATTGGAGGAACAAATGTTCGAAATGAAATGCAGAAGTTGCAGGCTGAAGCCCCTCACATTGTTGTTGGTACTCCAGGGAGAGTGTTTGATATGCTAAACAGAAGATACCTTTCTCCAAAATGGATCAAAATGTTCGTTTTGGACGAAGCAGATGAAATGTTGAGCCGAGGGTTTAAGGATCAGATCTATGAGATTTTCCAGAAATTAAATACAAGCATTCAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGCTAGAAGTGACCAAGAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATTAAACAATTTTATATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACTCTTTGTGACTTGTATGAGACTTTGACTATCACACAAGCAGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACGGAGAAAATGCATGCCAGGGACTTCACAGTTTCTGCTCTGCATGGTGACATGGACCAGAAGGAAAGAGATGTCATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGCCCGTGGGATTGACGTGCAACAAGTGTCCTTGGTTATAAACTACGATCTACCTACCAATCGTGAAAACTATATTCACAGGAGTCGATAGCGGCAGTTGATGACGAGATGGCACTCAGAAACGGCGTTGACGTAATTTAGGACGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAAATGCCCATGAATGTGGCTGACCTAATTTAATCCCTGGGATGAGATAGTTTTGAATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCCTTGAGAATATTTGAATCTTGTCTCAATGCTCATAACGGATCACAAATACAGATTCTGATAGCAAAGCGACTTTAGTCCTGAGCTCTTGTGAGGAAAGGCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGGTGGGTATAAAAGATGGGGTCTGTAAAATCTTTTTTTCTTAGAAATTCATTTACTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTGGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGACTAGAGAGGCCTTTAAAGTGATTTCTTTTTTTTAGAGAAAATTTGAATGCATTTTGTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCTCAGCAAGCAATCATCCTAGGTAGGGTTAAACCCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAAATTGTATATTCACTTTA