Transcript asmbl_20041

Sequence
Transcript Sequence for observation asmbl_20041 of TGE0031446:
CGCTGAGTGGGTTTTCGGATCATGTCTGGTGGCTCCGCGGATTACAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGGTAAGGAGTGGGTGTGGACGTTAAAGGTTTGGAAAGGTACATTTTTTTTTCATGTCTTATTCATAGTTTCATTATTAACTTACAGAGCAACTGGAATGAAATTGTTGATAACTTTGATGATATGAATTTAAAGGAGTCCCTTCTTCGAGGCATCTATGCATATGGTTTTGAGAAGCCTTCAGCTATTCAGCAAAGAGCTATTATCCCTTGTATTAAAGGTAAAACTCTATTGCCGTTAGGATAAGTGCTCTGCACATACATGGACCGGAAAAGGGAAAGTGACCTTTGGGGAAGTACTAGCACCTGATTGTATTCCTTAAAGTGAAATGATGGCAAATCATCTTTCGGGACTGACCTGAAATGAAGAGAATACTCTTGCTGATCACTTATGTGGGCGTAACTTTATGTTCCAACTGGAATACATGGTGTATAGTAGAAGTAACGATTTGATGTGGGATCGGTAAATATGTATCCTACTTTTTTTAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTTTGGCTCTTGGAGATTATATGGGAGCAACTTGTCATGCTTGCATTGGAGGAACAAATGTTCGAAATGAAATGCAGAAGTTGCAGGCTGAAGCCCCTCACATTGTTGTTGGTACTCCAGGGAGAGTGTTTGATATGCTAAACAGAAGATACCTTTCTCCAAAATGGATCAAAATGTTCGTTTTGGACGAAGCAGATGAAATGTTGAGCCGAGGGTTTAAGGATCAGATCTATGAGATTTTCCAGAAATTAAATACAAGCATTCAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGCTAGAAGTGACCAAGAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATTAAACAATTTTATATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACTCTTTGTGACTTGTATGAGACTTTGACTATCACACAAGCAGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACGGAGAAAATGCATGCCAGGGACTTCACAGTTTCTGCTCTGCATGGTGACATGGACCAGAAGGAAAGAGATGTCATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGCCCGTGGGATTGACGTGCAACAAGTGTCCTTGGTTATAAACTACGATCTACCTACCAATCGTGAAAACTATATTCACAGGAGTCGATAGCGGCAGTTGATGACGAGATGGCACTCAGAAACGGCGTTGACGTAATTTAGGACGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAGTCG