Transcript asmbl_20021

Sequence
Transcript Sequence for observation asmbl_20021 of TGE0007598:
CGGTACTCTGCCCTGTCTTACTTTTCTCCACGTGAGGGGGTGCGCGAATCCCCAGTGGTGGCCGCGCGCTCACATCCTCTGCAGCTTTCGTGCCCTTCGCGATGGCGGGCATCCTGTTCGAGGATATTTTCGATGTGAAAGACATCGACCCAGAAGGCAAGAAATTTGACCGAGTATCCCGGCTGCACTGTGAGAGTGAATCTTTCAAGATGGACCTCATCTTAGATGTAAACATTCAGATTTACCCTGTGGACTTAGGTGACAAGTTCCGGTTGGTTATAGCTAGTACTTTGTATGAAGATGGTACCTTGGATGATGGTGAATACAACCCCACAGATGACAGGCCTTCCAGGGCTGACCAGTTTGAGTATGTCATGTATGGGAAAGTGTACAGGATCGAAGGGGATGAGACCTCCACTGAAGCAGCCACACGCCTCTCTGCGTACGTGTCCTATGGGGGCCTGCTCATGAGGCTTCAGGGTGATGCCAACAACCTGCATGGATTTGAGGTGGACTCCAGAGTTTATCTGCTGATGAAGAAGCTGGCCTTCTGAACTTCGTGGGAAACCAGACTTGCTGCTTAGTCACTCATGTCATGGACACTGTTCAAGGCTGTGTAGAAGCTGTCGGTGTTAGCCTGTAAAAGGGGCGGAACTCTGTCCACTGTGGGGACGTCTTCAGTTTGTCTGAATGCAGTGGAAAACCGACTCTCCCTCTCGGAAGGCCGAGAGGGAGAACTTAGCATGAACCTGAAGTTGTATATGATTTTTTTTATTAAAGTTTTCTTTTTCA