Transcript asmbl_25169

Sequence
Transcript Sequence for observation asmbl_25169 of TGE0000811:
GGTGGCCGTGGCTGAGAGGAGACAGCGCCGCAGCACTGAGGGTTTGGGCTTGCAGGCGCTGCAGGAGACGCCCAGGCGGAGTCTTGTCTCGCAGCCAGCTCTGAGCGGGAGGCCTGAGCGGGAAGCATTGGCGTCCGAGCGACTTCTAGGAGCCTGGGGTTCGGCGCTATGGAGGAGCTCGATGGCGAGCCAACAGTCACTTTGATTCCAGGCGTGAATTCCAAGAAGAACCAAATGTATTTTGACTGGGGTCCAGGGGAGATGCTGGTATGTGAAACCTCCTTCAACAAAAAAGAAAAATCAGAGATGGTGCCAAGTTGCCCCTTTATCTATATCATCCGTAAGGATGTAGATGTTTACTCTCAAATCTTGAGAAAACTCTTCAATGAATCCCATGGAATCTTTCTGGGCCTCCAGAGAATTGACGAAGAGTTGACTGGAAAATCCAGAAAATCTCAATTGGTTCGAGTGAGTAAAAACTACCGATCAGTCATCAGAGCATGTATGGAGGAAATGCACCAGGTTGCAATTGCTGCTAAAGATCCAGCCAATGGCCGCCAGTTCAGCAGCCAGGTCTCCATTTTGTCAGCAATGGAGCTCATCTGGAACCTGTGTGAGATTCTTTTTATTGAAGTGGCCCCAGCTGGCCCTCTCCTCCTCCATCTCCTTGACTGGGTCCGGCTCCATGTGTGCGAGGTGGACAGTTTGTCGGCAGATGTTCTGGGCAGTGAGAATCCAAGCAAACATGACAGCTTCTGGAACTTGCCCGGGAACACCCAGACACTGACAGAGCTGGAGCTGAAGTGGCAGCACTGGCACGAGGAATGTGAGCGGTACCTCCAGGACAGCACATTCGCCACCAGCCCTCACCTGGAGTCTCTCTTGAAGATTATGCTGGGAGACGAAGCTGCCTTGTTAGAGCAGAAGGAACTTCTGAGTAATTGGTATCATTTCCTAGTGACTCGGCTCTTGTACTCCAATCCCACAGTAAAACCCATTGATCTGCACTACTATGCCCAGTCCAGCCTGGACCTGTTTCTGGGAGGTGAGAGCAGCCCAGAACCCCTGGACAACATCTTGTTGGCAGCCTTTGAGTTTGACATCCATCAAGTAATCAAAGAGTGCAGCATCGCCCTGAGCAACTGGTGGTTTGTGGCCCACCTGACAGACCTGCTGGACCACTGCAAGCTCCTCCAGTCACACAACCTCTATTTCGGTTCCAACATGAGAGAGTTCCTCCTGCTGGAGTACGCCTCGGGACTGTTTGCTCATCCCAGCCTGTGGCAGCTGGGGGTCGATTACTTTGATTACTGCCCCGAGCTGGGCCGAGTCTCCCTGGAGCTGCACATTGAGCGGATACCTCTGAACACCGAGCAGAAAGCCCTGAAGGTGCTGCGGATCTGTGAGCAGCGGCAGATGACTGAACAAGTTCGCAGCATTTGTAAGATCTTAGCCATGAAAGCCGTCCGCAACAATCGCCTGGGTTCTGCCCTCTCTTGGAGCATCCGTGCTAAGGATGCCGCCTTTGCCACGCTCGTGTCAGACAGGTTCCTCAGGGATTACTGTGAGCGAGGCTGCTTTTCTGATTTGGATCTCATTGACAACCTGGGGCCAGCCATGATGCTCAGTGACCGACTGACATTCCTGGGAAAGTATCGCGAGTTCCACCGTATGTACGGGGAGAAGCGTTTTGCCGACGCAGCTTCTCTCCTTCTGTCCTTGATGACGTCTCGGATTGCCCCTCGGTCTTTCTGGATGACTCTGCTGACAGACGCCTTGCCCCTTTTGGAACAGAAACAGGTGATTTTCTCAGCAGAACAGACTTATGAGTTGATGCGGTGTCTGGAGGACTTGACGTCAAGAAGACCTGTGCATGGAGAATCTGATACCGAGCAGCTCCAGGATGATGACATAGAGACCACCAAGGTGGAAATGCTGAGACTTTCTCTGGCACGAAATCTTGCTCGGGCAATTATAAGAGAAGGCTCACTGGAAGGTTCCTGAGAACTGCTTCAATGTGGTATCTTTGTATGGCAATGTATATAGATTTTTTTAAAAGAATAAATG