Transcript asmbl_19671

Sequence
Transcript Sequence for observation asmbl_19671 of TGE0032373:
TGCAGGCCGCGGTGTGCACGCGGATCTGCTCCGGAGTCCTGCAGCCCAGCCGCCGGCCGCAGTCTGGGTACCTGCGGAGCTTCTCTCTGCCGGTGCTGGGGTGCTGGGTGGACCCGCTGGCTTTCCAGGATGCGGGGCGTGGAACGTGGCCTCTGAGAACCCCAGGCGAGAGGAAGCCGTGCTGTAGGAGTCGTTAGGCACGGCGCTACCTGAAGCGGAAGCCGCGTTCACCCAGATCGTCTCCTGTGTCGCGCTTTAAAGTGGTTCCTCACATTTCTTCAAAATGAATGTGACTGTCCGTTTCTTAAGACCTTTTGCCAGATGTCTGGTGCCATATACCTTTCATAGGAAGAGAAGTCATTTATATTCAGGAGTTCTGCAGAGATACATGTCCTCCAAAGCACCTTCTTTGTCTTGTCATAATAAGGACAGTGCATCCCCTCCTGAGCAGCTAGAATTGGATGGGTGGAAAGCTACAATGAAGTCGAGCATTCAAGAAGATGGTGTTTCAGAGGTCTCAGACAAAGATGAAGATTCCCTCGCCTCAACCAGAGAACTAATTGAGATGTGGAGATTGCTTGGCAAAGAAGTACCAGAACATATTACTGAAGAAGATCTCAAAACCCTTATGGAATGTGCCTCTAAATCAGCCAAGAAGAAATACTTACGGTATCTGTATGGGAAGGAAAAGGCGAAAAAAGCTAAGCAGGTAAAGAAGGAGATGAAAGCGGAGGCCAGGGAAGAAGCAAAAAGGGCCAGGTTGCTAGAGACCACCGCAGAAGAACAACAGCAAGACTTCATGTTTCTTCGACTATGGGATCGACAGATCAACATTGCACTGGGTTGGAAGGGTGTCCAGGCTATGCAGTTTGGACAGCCTTTGGTTTTTGACATGGCCTATGATAATTACATGAAACCAAGTGAACTGCAGAATACTGTTTCTCAACTTTTAGAAAGTGAAGGATGGAACAGAAGAAATGTTGATCCTTTCCACATTTATTTCTGCAATCTTAAAATAGATAGTGCTTATCATAGAGAATTAGTTAAACGTTATAGAGAAAAATGGGACAAATTGCTCTTAACAGCAACAGAAAAGTCTCCTGTTGATTTATTTCCAAAGGACAGTATTATATATTTAACTGCAGATTCTCCCAATGTTATGACTACCTTCAAGCATGATAAAATTTATATAATTGGATCATTTGTTGATAAAAATACACAGACAGGAACATCCTTAGCCAAGGCCAAACGGTTAAACATAGCAACAGAGTGCCTTCCACTAGATAAATATTTACAATGGGAAATTGGTAACAAAAATCTCACCTTAGATCAGATGATCCGAATTTTGCTCTGCCTGAAAAACACTGGTAACTGGGAAGAGGCTCTCAAGTTTGTTCCCAGGAGAAAGCATACTGGTTATTTAGAGGTTTCTGAGCAATCTCAGGAACTTGTTAGGAAACTGAAGAAGACAAAGACTTTAAATTCATTTCGAAAAGGCTCCTTAAATGTGCGCACGTGGAAAAGGTGACCTAAGTGAGAAAGTATGGTGAAAGAAGAAAACAGG