Transcript asmbl_25167

Sequence
Transcript Sequence for observation asmbl_25167 of TGE0000810:
GGTGGCCGTGGCTGAGAGGAGACAGCGCCGCAGCACTGAGGGTTTGGGCTTGCAGGCGCTGCAGGAGACGCCCAGGCGGAGTCTTGTCTCGCAGCCAGCTCTGAGCGGGAGGCCTGAGCGGGAAGCATTGGCGTCCGAGCGACTTCTAGGAGCCTGGGGTTCGGCGCTATGGAGGAGCTCGATGGCGAGCCAACAGTCACTTTGATTCCAGGCGTGAATTCCAAGAAGAACCAAATGTATTTTGACTGGGGTCCAGGGGAGATGCTGGTATGTGAAACCTCCTTCAACAAAAAAGAAAAATCAGAGATGGTGCCAAGTTGCCCCTTTATCTATATCATCCGTAAGGATGTAGATGTTTACTCTCAAATCTTGAGAAAACTCTTCAATGAATCCCATGGAATCTTTCTGGGCCTCCAGAGAATTGACGAAGAGTTGACTGGAAAATCCAGAAAATCTCAATTGGTTCGAGTGAGTAAAAACTACCGATCAGTCATCAGAGCATGTATGGAGGAAATGCACCAGGTTGCAATTGCTGCTAAAGATCCAGCCAATGGCCGCCAGTTCAGCAGCCAGGTCTCCATTTTGTCAGCAATGGAGCTCATCTGGAACCTGTGTGAGATTCTTTTTATTGAAGTGGCCCCAGCTGGCCCTCTCCTCCTCCATCTCCTTGACTGGGTCCGGCTCCATGTGTGCGAGGTGGACAGTTTGTCGGCAGATGTTCTGGGCAGTGAGAATCCAAGCAAACATGACAGCTTCTGGAACTTGGTGACCATCTTGGTGCTGCAGGGCCGGCTGGATGAGGCCCGACAGATGCTCTCCAAGGAAGCCGATGCCAGCCCCGCCTCTGCAGGCATATGCCGAATCATGGGGGACCTGATGAGGACAATGCCCATTCTTAGTCCCGGGAACACCCAGACACTGACAGAGCTGGAGCTGAAGTGGCAGCACTGGCACGAGGAATGTGAGCGGTACCTCCAGGACAGCACATTCGCCACCAGCCCTCACCTGGAGTCTCTCTTGAAGATTATGCTGGGAGACGAAGCTGCCTTGTTAGAGCAGAAGGAACTTCTGAGTAATTGGTATCATTTCCTAGTGACTCGGCTCTTGTACTCCAATCCCACAGTAAAACCCATTGATCTGCACTACTATGCCCAGTCCAGCCTGGACCTGTTTCTGGGAGGTGAGAGCAGCCCAGAACCCCTGGACAACATCTTGTTGGCAGCCTTTGAGTTTGACATCCATCAAGTAATCAAAGAGTGCAGCATCGCCCTGAGCAACTGGTGGTTTGTGGCCCACCTGACAGACCTGCTGGACCACTGCAAGCTCCTCCAGTCACACAACCTCTATTTCGGTTCCAACATGAGAGAGTTCCTCCTGCTGGAGTACGCCTCGGGACTGTTTGCTCATCCCAGCCTGTGGCAGCTGGGGGTCGATTACTTTGATTACTGCCCCGAGCTGGGCCGAGTCTCCCTGGAGCTGCACATTGAGCGGATACCTCTGAACACCGAGCAGAAAGCCCTGAAGGTGCTGCGGATCTGTGAGCAGCGGCAGATGACTGAACAAGTTCGCAGCATTTGTAAGATCTTAGCCATGAAAGCCGTCCGCAACAATCGCCTGGGTTCTGCCCTCTCTTGGAGCATCCGTGCTAAGGATGCCGCCTTTGCCACGCTCGTGTCAGACAGGTTCCTCAGGGATTACTGTGAGCGAGGCTGCTTTTCTGATTTGGATCTCATTGACAACCTGGGGCCAGCCATGATGCTCAGTGACCGACTGACATTCCTGGGAAAGTATCGCGAGTTCCACCGTATGTACGGGGAGAAGCGTTTTGCCGACGCAGCTTCTCTCCTTCTGTCCTTGATGACGTCTCGGATTGCCCCTCGGTCTTTCTGGATGACTCTGCTGACAGACGCCTTGCCCCTTTTGGAACAGAAACAGGTGATTTTCTCAGCAGAACAGACTTATGAGTTGATGCGGTGTCTGGAGGACTTGACGTCAAGAAGACCTGTGCATGGAGAATCTGATACCGAGCAGCTCCAGGATGATGACATAGAGACCACCAAGGTGGAAATGCTGAGACTTTCTCTGGCACGAAATCTTGCTCGGGCAATTATAAGAGAAGGCTCACTGGAAGGTTCCTGAGAACTGCTTCAATGTGGTATCTTTGTATGGCAATGTATATAGATTTTTTTAAAAGAATAAATGTTGTTTTGCA