Transcript asmbl_192

Sequence
Transcript Sequence for observation asmbl_192 of TGE0032174:
CTGAGTCTAAAGGGTCTGGGTCTAAAGACACGCTTAAAATTTGGCTCAAGCTAGTTATTTTCTTTATTTTCCTAATAGATTACGAATCTAGATAGATAAGAAACAAAAGTCTTAAGGGGACTGGATGCTTTTAGGACTACGCTTGACTAATCGATGTTTCCTAAATCTCGGAATAGGTACTTGATGTGTGCGGGCTGGGCGCTGGTGGAAATCGAACCTCGTGGTATGTTCTGTAGGAACCTGAGGGAGCTAACTGAAGCCTAGCTCCTGCTGCGCTTGCGGCGCAGTCTACCTTAGAGCTGCTTGATTATCAACGCACACATTTTCGTGGAGAAGTCTCGTGTGTATATTCAGCCATGGCACAACTCCAGGCACGTTTCTACAGCGAGAACAAGAAATACGCAGTGGATGATGTCCCTTTCTCAATCCCTGCCGCTGCTGAAGTTGCGGACCTTAGTAACATTATCAATAAGTTGCTGGAGACCAAAAATGAACTCCACAAGCATGTCGAGTTTGATTTCCTTATCAAGGGCCAGTTTCTTCGAGTGCCCTTGGTCAAACACATGGAACTGGAGAACATTTCATCGGAAGAGGTTGTGGAACTAGAATATGTGGAAAAGTACACCGCACCCCAGCCAGAGCAGTGCATGTTCCATGATGACTGGATCAGCTCAATTGAAGGGGCAGAAGAATGGATCCTGTCTGGTTCTTATGATAAGACTTCTCGGATCTGGTCCTTGGAAGGAAAGTCGATAATGACAATTGTGGGACATACAGATGTTGTGAAAGATGTGGCTTGGGTGAAAAAAGACAGTTTGTCCTGCTTACTACTGACGGCCTCGATGGACCAGACTGTTCTCTTATGGGAGTGGAATGTAGAGAAGAACAAAGTGAAAGCTCTGCACTGCTGCCGAGGGCATGCTGGGAGTGTGGACGCCATCGCAGTCGATAGCTCGGGAGCTAAGTTTTGCAGTGGCTCCTGGGATAAGATGCTAAAGATCTGGTCTACAGTCCCTACAGATGAAGAAGATGAAATGGAAGAAGCCACAAATCGACCAAGAAAAAAGCAAAAAACAGAACAATTGGGACTAACAAGAACACCCTTGGTGACCCTCTCTGGCCACACAGAAGCAATTTCCTCAGTCCTTTGGTCAGACGCTGAAGAAATCTGTAGTGCATCTTGGGATCACACAATTAGAGTGTGGGATGTTGAGTCTGGCGGTCTTAAGTCAACTCTGACAGGAAATAAAGTGTTTAATTGTATTTCCTATTCTCCCCTTTGTAAACGTTTGGCATCTGGAAGCACAGACAGGCATATTAGACTGTGGGATCCCCGAACTAAAGATGGTTCTTTGGTGTCGCTGTCTCTCACCTCACACACAGGCTGGGTGACATCAGTGAAGTGGTCTCCTACCCATGAACAGCAGCTCATCTCGGGCTCTTTAGATAACATTGTGAAGCTATGGGATACAAGAAGCTGTAAGGCTCCTCTCTACGATCTAGCTGCTCATGAAGACAAAGTTCTAAGTGTGGACTGGACAGACACAGGGCTACTTCTGAGTGGAGGAGCAGACAATAAATTGTATTCCTACAGCTATTCCCCTACCACTTCCCATGTGGGGGCTTGAAAATGAATGGCTGAGAAGAGACTTCCTTGTTGGGTCTTGTCTTAATTCTTAGTGTCTCACTGTTATTTCATAAACTGAATCAAATTTGAGAGAGGACTTATAGTACAGCTCAGCTGGTAGAATGCTTGCCTAAAATGTGCACAGCCCTGCATGCTATCTCCAGCACTGCCCAAAGAAAAATGGGCATGGTAGCACATTCCTGTAATCCCAGTCCTAGAGGTTGGAAGCAAGAGCATCAGAAATTCAAGGTCACCCTCTGCTGTATAGTGAGCTTAAAGGCAGCCAGCCATGGTTCCCTGAGTCTCTGTCTCCATAAGAAAGAAATCAATGGATAATCCTCTGATATCATTGTCAATGCAGAGACAGGAAGCAGCCTTTTAAAATTTGGATAACAGTTCATCTTTCATAATAGCAACATTTTACTGTCTTTGTCCTTCGTGCTTATAAAATACAGTAAGTATGTGGTCTGAATTCTGTCTACATTTTACCCTATGTAGACTCCTAAAACTTGA