Transcript asmbl_11085

Sequence
Transcript Sequence for observation asmbl_11085 of TGE0000080:
GGGGGGAACTCAAGGCCTGCTTGATACGTCCGCCATTTTGGGCGCTTCGCTGATGGTGTCGGTGAGCGCGTTTCCCGCCTGAGCGCAACTAGCGGCGGGTCGTGGGCACCTCCAGGAGAGCTTGTTTCATATCCATATCCCACTGTATTCCTGCTAATCTGCTAATGCAGTAAATTGGAGGAAAACTGTTACCAGGATAACCTGTAATGGGCAAGGAGCCACAAAGAAGAAAACATTTCTTTTAATTTTTAAACTTGGTTTGAAAGGTATCCAAATATATCTTGTGAGTTGCTCACTTCTGATGTCTCCCAGATGAATGATAGACTGGGAGAAGATGAATCCTTGCTAATGAAATTATATAGCTTCCTCCTAAACGATTCCCCTTTGAATCCACTACTTGCCAGTTTCTTCAGCAAGGTGCTAAGTATTCTTATCAGCAGAAAACCAGAACAGATTGTGGATTTCTTAAAGAAGAAGCATGATTTTGTAGACCTTATTATAAAGCACATAGGAACTTCTGCTATCATGGATTTGTTGCTCAGGCTCCTGACGTGTATCGAACCTCCACAGCCCAGGCAAGATGTGCTGAATTGGTTAAATGAGGAGAAAATTATCCAGAGGCTTGTGGAAATAGTTCATCCATCGCAAGAAGAAGATCGACATTCAAATGCATCACAATCACTTTGTGAAATTGTTCGCCTGAGCAGAGACCAGATGTTACAAATTCAGAACAGTACAGAGCCCGACCCCCTGCTTGCCACTCTAGAAAAGCAAGAAATTATAGAGCAGCTTCTATCAAATATTTTCCACAAGGAGAAAAATGAGTCAGCCATAGTCAGTGCAATCCAGATATTGCTGACTTTACTTGAGACACGACGACCAACATTTGAAGGCCATATAGAGATCTGCCCACCAGGCATGAGCCATTCAGCTTGTTCAGTAAACAAGAGTGTTCTAGAAGCCATCAGAGGAAGACTTGGATCTTTTCATGAACTCCTGCTGGAGCCACCCAAGAAAAGTGTGATGAAGACCACATGGGGTGTGCTGGATCCTCCTGTGGGGAATACCCGGTTGAATGTCATTAGGTTGATATCCAGCCTGCTTCAAACCAATACCAGCAGTATAAATGGGGACCTTATGGAGCTGAATAGCATTGGAGTCATATTGAACATGTTCTTCAAGTATACATGGAATAACTTTTTGCATACACAAGTGGAAATTTGTATTGCACTGATTCTTGCAAGTCCTTTTGAAAACACAGAAAATGCCACAATTACCGATCAAGACTCCACTGGTGATAATTTGTTATTAAAACATCTTTTCCAAAAATGTCAATTAATAGAACGAATACTTGAAGCCTGGGAAATGAATGAGAAGAAACAGGCTGAGGGAGGAAGACGGCATGGTTACATGGGACACCTAACGAGGATAGCTAACTGTATCGTGCACAGCACTGACAAGGGCCCCAACAGTGCATTAGTGCAGCAGCTTATCAAAGATCTTCCCGACGAAGTCAGGGAACGATGGGAGACGTTCTGCACAAGCTCCTTAGGAGAAACTAACAAGAGGAACACGGTAGATCTAGTTACAACCTGCCATATTCATTCATCCAGTGATGATGAAATTGACTTTAAAGAAACGGGTTTCTCACAGGATTCTTCTTTGCAGCAAGCCTTTTCTGATTATCAGATGCAACAAATGACGTCCAATTTTATTGACCAGTTTGGCTTCAACGATGAGAAGTTTGCAGATCAAGATGACATTGGCAATGTTTCTTTTGATCGAGTATCAGACATCAACTTTACTCTCAATACAAATGAAAGTGGAAATATTGCCTTGTTTGAAGCATGTTGTAAGGAAAGAATACAACAGTTTGATGATGGTGGCTCTGATGAGGAAGATATATGGGAGGAAAAGCACATCGCATTCACACCAGAATCCCAAAGACGATCCAGCTCGGGGAGTACAGACAGTGAGGAAAGTACAGACTCTGAAGAAGAAGATGGAGCAAAGCAAGACTTGTTTGAACCCAGCAGTGCCAACACGGAGGATAAAATGGAGGTGGACCTGAGTGAACCACCCAACTGGTCAGCTAACTTTGATGTCCCAATGGAAACAACCCACGGTGCTCCATTGGATTCTGTGGGATCTGATGTCTGGAGCACAGAGGAGCCGATGCCAACTAAAGAGACGGGCTGGGCTTCTTTTTCAGAGTTCACGTCTTCCCTGAGCACAAAAGATTCTTTAAGGAGTAATTCTCCAGTGGAAATGGAAACCAGCACTGAACCCATGGACCCTCTGACTCCCAGTGCGGCTGCCCTGGCAGTGCAGCCAGAAGCGGCAGGCAGTGTGGCCATGGAAGCCAGCTCTGACGGAGAGGAGGATGCAGAAAGTACAGACAAGGTAACTGAGACAGTGATGAATGGCGGCATGAAGGAAACGCTCAGCCTCACTGTAGATGCCAAGACAGAGACTGCGGTCTTCAAAAGTGAGGAAGGGAAACTGTCTACCTCTCAAGATGCTGCTTGTAAAGACGCAGAGGAGTGTCCCGAGACTGCAGAGGCGAAGTGCGCGGCGCCCAGGCCTCCCAGCAGCAGTCCCGAGCAGAGGACTGGCCAACCAAGCGCACCAGGTGACACTTCAGTGAATGGCCCTGTATGACGGGTGACGTCTGCTGCTGCTGACTGAGGACTGCAGACCGCCACCACTCAGGGGCTCTGGAGGGGTCAGCTGGAGCCCACCAAGCTGTCACTGCTGCACTCACTCTGCAAGGGATCAGGACCAGCAACCTTTATATTCTAGATTCTAAGACATTGTACAGAGAAATTCAGAAGTGTAAAAATATTGCACATTGACAAATACCAAGAATTTTTGCGTATGTTTATATTGTATTGTTCTAAATAATGGGTAGCCTGTGAAATAAGATCTTGCCACCCATGTAATAATAGTAGTAATACTATAGTTAAAATGGCTGTAAGAATAGTTTTATAAAAGTGAATACACAGATCTATTGTATTTGAAACATAACTTTGACAATTATTAGTGTGACCAAAGTATTAGGCGGTTTTCATACATTTTTCACCTTGTACAAAATTATGAATTCATTTTTCCTCCAGGCCGACAAGGAGTTGTAGAATGAAAATGCCCTCTAAGTGTTATTTTGGTTGTTCTAACTTACAAAAGTGATTTTGAATAAGAAATATTTGGTGTTCTTTTTATAACCAGTTTTTGATTGGTAATTGTTTTCTGTATTGTTTAAAACGGATCAAAAATGTAAGTCTATTGGTAGAGATTAAGTAAAGTATTTATTGCTACATCATAGTTGATAAATTGATGTTATCGTAAAGCCATATGTTCTGTTCAAGTCTTGTTTGCTTGAAATGATTATTCCTACAAGTGAAACACTAGACTATTTGGAGTGT