Transcript asmbl_18596

Sequence
Transcript Sequence for observation asmbl_18596 of TGE0000137:
GGTGGGTGTTCGCCGCACAGCTCCTGTCGCCGTCGCGGCTTCCGGTGCTAGGTGGAGGGCGGGCAGGAGGGAGCCGGGGAGCGGGCCAGCGGACCATCTTCACCGCGGTCGGGTCGGCTTGCGGAGCGGGAGGCAGCGGCCGGAGAGCCGGGCGGAACCTGCGGGGGCGGAGGCGGCGGTGGCAGCCGCGGCGCAGGGAGCAGGAACAGGGTCAAGTCCTCCATACCAAGGACCAGGCTAAAACCAGATTACACTGCCCCTCCCTGGGCCCTATTGACTTAAAGCAGCCACTGTAATCATGGGCAATATCTTTGGGAACCTTCTGAAGAGCCTAATCGGCAAGAAGGAGATGCGCATCCTGATGGTGGGCCTGGATGCTGCCGGGAAGACCACCATCCTCTACAAGCTGAAACTCGGGGAGATTGTCACCACCATCCCGACCATTGGGTTTAATGTGGAGACAGTGGAATATAAGAATATCAGCTTCACAGTCTGGGACGTAGGTGGCCAGGACAAGATTCGGCCCCTCTGGAGACACTACTTCCAGAACACCCAAGGCTTGATATTTGTGGTTGACAGCAATGATCGGGAGCGAGTGAACGAGGCCCGGGAAGAGCTGATGAGGATGCTGGCGGAGGATGAGCTCCGGGATGCTGTGCTCCTTGTGTTTGCAAACAAACAGGATTTGCCGAATGCTATGAATGCTGCTGAGATCACAGACAAGCTGGGGCTGCACTCCCTGCGTCACCGCAATTGGTACATTCAGGCCACCTGTGCTACCAGCGGGGACGGGCTGTATGAAGGCTTGGACTGGCTGGCCAATCAGCTCAAAAACAAGAAGTGAGAGCCAGGCAGCCCTCTCTGACTACCCCACCCACTCCTGACACACACCTGCTGTCTCCTTACCCCAATTTTCCCTTCTTCCTCTTGAAAGTGGCCAAGGTCCTGGGTATCATGTCCACATGCCCAGCAAGCGCCTTGCCTTCCTCCTCCTCCTCCTCCTCCCTCCTCCCTCCTCCCTCC