Transcript asmbl_18363

Sequence
Transcript Sequence for observation asmbl_18363 of TGE0032237:
GCGGCCGCCGCCATTTTGTGCAGTTGCTGGGAAGGAAGGGAGACGCCTCAACCGTGGCACCGCCCGGTTTGAGCGGGACCAGACCTCCCGACTGTCCTAACAACCCCGATTCTCTGAGTTGTGCTCCCGTCTCCGACGAGAGAGGCGGCGACGGTGGCGTCTGCGACGGGAGACAGCGCGTCGGAGCGAGACAGCGCCGCGCCTGCCGCCGCCCCAACAGCGGAGGCGCCGCCGCCGCCATCGGTCATCACTAGACCCGAGCCGCAGGCCCTCCCGAGCTCGGTCATCCGTGCCCCGCTCCCAGATCTTTATCCGTTTGGGACCATGCGTGGAGGCGGCTTTGGGGATCGGGATCGTGACAGGGACCGTGGAGGGTTTGGAGCAAGAGGTGGTAGTGGGCTTCCCCCTAAGAAGTTTGGTAATCCTGGGGAGCGGTTACGAAAAAAGAAGTGGGATTTGAGTGAACTCCCTAAATTTGAGAAGAATTTTTATGTTGAGCATCCAGAAGTAGCAAGACTGACTCCGTATGAGGTTGATGAGCTACGGCGTAAGAAAGAGATTACAGTGAGAGGGGGAGATGTTTGTCCAAAACCTGTCTTTGCCTTCCATCATGCTAACTTTCCACAGTATGTGATGGATGTGCTGATGGATCAGCACTTTACAGAACCCACTCCCATTCAGTGCCAGGGATTTCCTTTGGCTCTTAGTGGCAGGGATATGGTTGGCATTGCACAGACTGGCTCTGGGAAGACATTGGCGTATTTGCTGCCTGCGATTGTTCATATAAACCACCAGCCATACTTGGAAAGAGGAGATGGTCCAATTTGTCTAGTGCTGGCTCCTACCAGAGAGCTTGCGCAGCAGGTGCAGCAGGTGGCTGACGATTATGGAAAATGCTCCAGGTTGAAGAGTACGTGCATTTACGGAGGTGCTCCTAAAGGTCCCCAAATTCGAGACTTGGAAAGAGGTGTTGAGATTTGCATAGCCACTCCTGGGCGCCTAATAGATTTCCTGGAGTCAGGAAAGACAAACCTTCGCCGATGTACTTACCTTGTGTTGGATGAGGCTGACCGGATGCTTGATATGGGCTTTGAGCCCCAGATCCGTAAAATTGTTGATCAAATCAGGCCTGACCGGCAGACACTGATGTGGAGTGCAACCTGGCCGAAGGAAGTGAGGCAGCTTGCAGAGGATTTCCTGCGGGACTACACCCAGATCAATGTGGGCAATCTGGAGCTGAGTGCCAACCACAACATCCTACAGATTGTAGATGTCTGTATGGAGAGTGAAAAAGACCACAAATTGATCCAGCTGATGGAGGAAATCATGGCGGAAAAGGAAAATAAGACTATAATATTTGTGGAGACAAAGAGGCGCTGTGATGACCTCACACGAAGAATGCGCAGAGATGGTTGGCCTGCTATGTGTATCCATGGAGACAAGAGTCAACCAGAAAGAGATTGGGTACTTAATGAGTTCCGATCTGGAAAGGCTCCTATCCTCATTGCCACGGATGTAGCCTCCCGTGGGCTAGATGTGGAAGATGTCAAGTTTGTCATCAACTACGATTATCCAAACAGCTCAGAGGATTATGTTCACCGTATTGGCCGAACGGCCCGCAGCACCAACAAGGGCACTGCCTATACTTTCTTTACCCCGGGCAACCTGAAGCAGGCTAGAGAGCTGATCAAAGTATTGGAAGAGGCCAATCAAGCCATCAATCCAAAATTGATGCAGCTTGTGGACCACAGAGGTGGCGGCGGAGGAGGGGGAGGCCGCTCACGATACCGGACTACTTCTTCAGCCAACAATCCCAATCTGATGTATCAGGACGAGTGTGACCGGAGGCTTCGAGGGGTCAAGGATGGTGGCCGGAGAGATTCTACAAGCTACAGGGATCGTAGTGAAACCGATAGAGCCAGTTATGCTAATGGCAGTGGCTATGGAAGCCCAAATTCTGCCTTTGGGGCACAAGCAGGCCAATACACCTATGCTCAAGGCACCTATGGGGCAGCTGCCTATGGCACCAGTGGCTACACGGCGCAGGAGTATGCTGCTGGCACTTACGGGGCGAGCAGCACTGCCTCAGCAGGGAGGAGCTCTCAGAGCTCCAGCCAGCAGTTTAGTGGGATAGGCCGATCTGGGCAGCAGCCACAGCCACTGATGTCACAGCAGTTTGCACAGCCTCCAGGAGCTACCAATATGATAGGCTACATGGGGCAGACTGCTTACCAGTACCCTCCCCCTCCCCCTCCCCCTCCTCCATCTCGCAAATGAAACTGCATGGCAGGAGTGACTCGTGCAGATGAATTACACATCTAAAGGAACACTGTCTTTTACCCTTCTAGACCTTTTCATTTTTATTTTTTCTTTTCTCAACCATTACGGTTTATCTTTTTTTAATGCAGATAGTTAAAATTTCACTGCCAGGTTTCTTCTGCCCACCCAAAAGATCCAGTCTATAATTACAGATTTTGTAAGAAAAAATATATATACACATAACTGACTGGAAAGAATTAATTTCTTTCCCCCAGCTTAATGCATGTTGAGGATATTGAGCTATTTTTCATCTTAAAGGTATTAGGCACTTTTGTTGGAGCCTGTTTATCCATG