Transcript asmbl_25154

Sequence
Transcript Sequence for observation asmbl_25154 of TGE0000808:
TGAGTCTTGATCCTCGGCAGGCACCGTACCCAGTTTCCTCCGTTGGGAGGGTTTAACTGCCCGGAAACGGAAGTCTCGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCGCGCCTCGTCGCCATGCCTCGGAAAATTGAGGAAATCAAGGACTTCCTGCTCACAGCCCGACGAAAGGATGCCAAATCTGTCAAGATCAAGAAAAATAAGGACAACGTGAAGTTTAAAGTTCGATGCAGCAGATACCTTTACACCCTGGTCATCACTGACAAAGAGAAGGCAGAGAAACTGAAGCAGTCCCTGCCCCCCGGTTTGGCAGTGAAGGAACTGAAATGAACCAGACACACTGATTGGAACTGTATTATATTAAAATACTAAAAATCCT